An integrated analysis of cell-type specific gene expression reveals genes regulated by REVOLUTA and KANADI1 in the Arabidopsis shoot apical meristem
Authors:
Hasthi Ram aff001; Sudeep Sahadevan aff001; Nittaya Gale aff003; Monica Pia Caggiano aff001; Xiulian Yu aff001; Carolyn Ohno aff001; Marcus G. Heisler aff001
Authors place of work:
European Molecular Biology Laboratory, Meyerhofstrasse, Heidelberg, Germany
aff001; National Agri-Food Biotechnology Institute, SAS Nagar, Mohali, Punjab, India
aff002; School of Life and Environmental Sciences, University of Sydney, NSW, Australia
aff003
Published in the journal:
An integrated analysis of cell-type specific gene expression reveals genes regulated by REVOLUTA and KANADI1 in the Arabidopsis shoot apical meristem. PLoS Genet 16(4): e32767. doi:10.1371/journal.pgen.1008661
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1008661
Summary
In the Arabidopsis thaliana shoot apical meristem (SAM) the expression domains of Class III Homeodomain Leucine Zipper (HD-ZIPIII) and KANADI (KAN) genes are separated by a narrow boundary region from which new organs are initiated. Disruption of this boundary through either loss of function or ectopic expression of HD-ZIPIII and KAN causes ectopic or suppression of organ formation respectively, raising the question of how these transcription factors regulate organogenesis at a molecular level. In this study we develop a multi-channel FACS/RNA-seq approach to characterize global patterns of gene expression across the HD-ZIPIII-KAN1 SAM boundary. We then combine FACS, RNA-seq and perturbations of HD-ZIPIII and KAN expression to identify genes that are both responsive to REV and KAN1 and normally expressed in patterns that correlate with REV and KAN1. Our data reveal that a significant number of genes responsive to REV are regulated in opposite ways depending on time after induction, with genes associated with auxin response and synthesis upregulated initially, but later repressed. We also characterize the cell type specific expression patterns of auxin responsive genes and identify a set of genes involved in organogenesis repressed by both REV and KAN1.
Keywords:
Gene expression – Gene regulation – Epidermis – Organogenesis – Gene ontologies – Auxins – Cytokinins – Meristems
Introduction
The plant shoot apical meristem (SAM) is a dynamic tissue that maintains pluripotent stem cells at its center while generating lateral organs such as leaves and flowers from its periphery. Organogenesis is triggered by the local accumulation of the plant hormone auxin [1], which accumulates periodically at sites of organ formation due to a positive feedback loop between polar auxin transport and the activity of Auxin Response Factor 5 (ARF5) or MONOPTEROS (MP) [2, 3]. However, the response of the meristem to auxin in terms of organogenesis and auxin transport is confined to the meristem peripheral zone. For instance, auxin application to the center of pin1 mutant meristems only triggers organogenesis in the meristem periphery [1]. Like-wise, changes to PIN1 polarity in response to altered MP activity only occur within the peripheral zone [3]. Recent work reveals that the positioning of organs in the peripheral zone depends on the function of genes involved in leaf dorsoventrality. Genes encoding the Class III homeodomain-leucine zipper (HD-ZIP III) transcription factors are expressed centrally in the meristem while the KANADI (KAN) genes are expressed in the periphery. New organ initiation sites, marked by high levels of PIN1 expression and convergent patterns of polarity in the epidermis, are centered on cells located between these two expression domains, although high auxin levels at the initiation site subsequently promote the expansion of REV expression into the developing primordium [4]. Since loss of function mutations in either set of genes results in ectopic organ formation while ectopic expression of either type of gene can suppress new organ formation, these genes are thought to act within their expression domains to suppress organogenesis. A major challenge is to understand how this regulation is accomplished.
Previous work on seedlings has suggested that the suppression of organogenesis by these genes may occur through their direct repression of auxin transcriptional response since the Auxin Response Factors (ARFs), ARF3 and ARF4 are known to work in conjunction with KAN1 and KAN2 to repress ectopic growth from ventral leaf tissues [5]. Furthermore, ARF2, ARF3 and ARF4 are known to directly repress WOX1 and PRESSED FLOWER (PRS) in the same leaf domain [6]. Lastly, several previous studies have shown that auxin transcriptional reporter genes appear restricted in their response to auxin in the inflorescence meristem and leaves [4, 7, 8]. So far, target gene analysis for HD-ZIPIII transcription factor REVOLUTA (REV) and KAN1 has focused on seedling tissue and on leaf development in particular. Also, although several studies support a role for the KAN genes in repressing auxin-related genes [9–13], the HD-ZIPIII proteins have been mostly associated with promoting auxin responses, primarily through the activation of genes involved in auxin synthesis [12, 14]. Hence it remains unclear how the HD-ZIPIII genes repress organogenesis and whether the genes responsive to REV and KAN1 in seedlings are similar in the shoot meristem.
In this study we investigate the role of KAN1 and REV in the shoot. The shoot meristem however is a complex structure with many distinct cell types, each expressing distinct sets of genes. Potentially each of these cell types may also respond in different ways to the same transcription factor depending on interaction partners and co-expressed regulators. To address the complexity of this tissue we utilize live-imaging combined with perturbations to REV and KAN1 expression. We also develop a combinatorial FACS-based transcriptomics approach, using several GFP variants to identify gene expression profiles specific to REV, KAN1 and boundary cell types which also alter their expression in response to REV and KAN1 perturbations. Our results reveal that although both REV and KAN1 suppress organ formation, the way in which this is achieved is different in each case. While REV expression appears capable of blocking auxin signaling in a generic manner, this is an indirect consequence of REV expression which contrasts with short term responses. In contrast, KAN1 influences gene expression more consistently but also more specifically in terms of individual auxin-regulated genes. Finally, our results also identify other hormone pathways regulated by these genes that are known to be critical for organogenesis.
Results and discussion
Transcriptional profiling of cells located across the REV-KAN1 boundary domain of the SAM
The HD-ZIPIII and KAN genes play a key role in the A. thaliana SAM by helping to specify organ positioning, cell type patterning and organ morphogenesis [4]. Identifying the global regulatory network underlying the function of these genes is therefore a major priority for advancing our understanding of these processes. We approached this challenge using a strategy that combines RNA-seq-based cell type profiling with RNA-seq-based identification of genes differentially expressed in response to transcription factor perturbations. Previous approaches for transcriptome profiling specific cell types in plants, including studies utilizing FACS, INTACT (isolation of nuclei tagged in specific cell types) and TRAP (translating ribosome affinity purification), have been limited to the collection of a single cell-type using one specific promoter at a time [15–18]. However our previous work demonstrated not only the importance of the REV and KAN1 expression domains but also specifically their epidermal expression and the importance of epidermal cells located in between their domains [4]. Taking into account these findings we developed a combinatorial FACS based transcriptomics approach that utilized three distinct fluorescent proteins to label REV, KAN1 and all epidermal cells (Fig 1A). To label all epidermal cells we used the A. thaliana Meristem Layer1 (AtML1) promoter [19] to drive the blue fluorescent protein mTag-BFP [20] fused to an endoplasmic reticulum localization sequence (mTag-BFP-ER). To label REV and KAN1 expressing cells we used functional fluorescent protein translational fusions to these proteins under their own regulatory control (pREV::REV-2YPET and pKAN1::KAN1-2GFP) as described previously [4]. Cells only expressing mTag-BFP-ER are predicted to be epidermal cells predominantly located in the peripheral zone in between the KAN1 and REV domains [4]. The three markers were transformed consecutively into an apetala1-1 cauliflower1-1 (ap1cal) double mutant plant line in order to combine them and enable the collection of large numbers of protoplasts derived from meristem tissues as described previously [21]. Imaging these transgenic lines confirmed their predicted expression patterns (Fig 1B–1G). From FACS sorting of protoplasts from these plants, six different cell-types were collected, namely epidermal REV (sorting for double positive for BFP and YFP), epidermal KAN1 (sorting for double positive for BFP and GFP), epidermis without REV or KAN1 (sorting for BFP-only), sub-epidermal REV (sorting for YFP alone), sub-epidermal KAN1 (sorting for GFP alone) and all negative (sub-epidermal cells not expressing any fluorescent protein) (S1 Fig). Q-PCR assays, using RNA extracted from the collected protoplasts, for genes known to be expressed specifically in these cell types confirmed the purity of the sorting and enrichment of marker gene expression (S2A–S2C Fig). Isolated RNAs were then sequenced using Illumina HiSeq 2000. Principle component analysis (PCA) of the sequencing data revealed close clustering of biological replicates, and separation of the cell-type profiles (S2D Fig). PCA analysis further indicated that most variation could be explained by differences in epidermal vs non-epidermal identities as well as KAN1 vs non-KAN1 expressing cells (S2D Fig). To identify genes that are differentially expressed between the cell types, we grouped the six cell types into two groups: epidermal and sub-epidermal and then compared one cell type against the remaining two cell-types within their own epidermal or sub-epidermal group. We considered a gene differentially expressed if it exhibited a log2 Fold Change (FC) of greater than 1 in at least one cell-type compared to the any of the remaining two cell-types within the group, with an adjusted p-value of <0.05. With these criteria, we identified 1769 genes up-regulated in epidermal REV cells, 2090 genes up-regulated in KAN1 epidermal cells and 1961 genes up-regulated in BFP-only cells (S1 Table). Through further analysis, we identified different subsets of genes that exhibited distinct enrichment patterns between the epidermal cell-types (Fig 1H, S2 Table). Similarly, in the sub-epidermis we identified 2330 genes up-regulated in REV expressing cells, 1211 genes up-regulated within the KAN1 domain and 2153 genes in cells expressing neither REV nor KAN1 (S3 Table). Overall our approach was successful in identifying more than 4600 genes differentially expressed in at least one of the three epidermal cell types out of around 22,000 genes with expression detected in the SAM. Comparing to previous studies, our results indicate good concordance. For instance, 186 genes were previously identified to be upregulated in KAN1 expressing cells compared to other SAM cell types (S4 Table) [18]. Of these, 76% were overlapping with our total cell-type specific genes, and of these overlapping genes, 44% were specifically upregulated in KAN1 expressing SAM cells (S3 Fig). Overall however we detected many more such genes (1314), possibly because of differences in the cell types compared as well as a higher sensitivity for RNA-seq compared to microarray analysis. To further check the accuracy of our analysis, we examined the published expression patterns of genes for which expression data are available by means of RNA in-situ hybridization, GUS staining or fluorescence reporters. Of 48 such genes in our analysis, 44 (92%) of them were enriched in the predicted cell-types (S5 Table). We also examined the expression of 14 genes that had either not been characterized before or not had their expression pattern examined with reference to other markers such as PIN1-GFP or REV-YFP/KAN1-GFP. Of these, 10 exhibited expression patterns that matched predicted patterns based on our FACS RNA-seq data (S4 Fig). Two of the remaining markers did not exhibit expression in the SAM suggesting that these reporters may not accurately reflect the expression pattern of the corresponding gene.
Clustering and GO term enrichment for clusters
We next focused our expression analysis on epidermal cell-types. From here onwards, unless stated otherwise, the terms ‘REV domain/cells’ and ‘KAN1 domain/cells’ are used to denote REV epidermal and KAN1 epidermal cells, respectively while ‘BFP-only’ refers to those epidermal cells not labelled with the REV and KAN1 markers. To gain an overview of differential gene expression in the SAM epidermis, we used consensus clustering and identified 15 sets of genes with distinct patterns of expression with respect to the three cell types (Fig 1I). Gene Ontology (GO) enrichment analysis of these clusters identified significant GO terms associated with various biological functions (S6 Table). Notably, genes associated with the GO terms organ development, cell growth, auxin response and auxin transport were overrepresented in clusters 5 and 6, which represent genes that are expressed relatively highly within BFP-only cells. Genes associated with organ development as well as cell-cycle and meristem function were enriched in Cluster 1, which represents genes expressed relatively highly in the REV domain (S6 Table, Fig 1I). Genes associated with auxin synthesis, auxin response and stress response were significantly enriched in clusters 2, and 4, which represent genes expressed relatively highly in the KAN1 domain as well as BFP-only cells. We also note that genes related to stress were also enriched in clusters marked by relatively low REV expression, although this did not apply to all such clusters (Fig 1I). Example of specific genes associated with these clusters and GO terms are given in the supplementary results (S1 Text).
Identification of REV and KAN1 responsive genes in the SAM
Having identified genes that are differentially expressed between the REV, KAN1 and BFP-only cell types, we next asked which genes alter their expression levels in response to perturbations in REV or KAN1 expression. To increase the specificity of our experiment we again focused on the epidermis by limiting our ectopic expression perturbations to the epidermis and by specifically isolating epidermal cells for RNA-seq based analysis. In two sets of experiments we either induced YFP tagged MIR165/166-resistant REV (REVr-2VENUS) or GFP tagged KAN1 specifically in the epidermis using the AtML1 promoter and dexamethasone regulated GR-LhG4/6XOP two-component system [22]. We refer these two constructs as pAtML1>>REVr-2VENUS and pAtML1>>KAN1-2GFP, respectively. RNA was then purified specifically from epidermal cells using FACS, in an ap1cal mutant background using the ectopically expressed tagged REV and KAN1 proteins for sorting. The phenotypic consequences of these perturbations in ap1cal mutants were similar to those found for the wild-type, where organogenesis is suppressed and meristems become pin-shaped [4] (S5 Fig). For both the ectopic REV and KAN1 experiments we sorted the epidermal cells using FACS, 6 and 16 hours (hrs) after induction (S6 Fig). For our control experiment we collected epidermal cells labelled by BFP-ER after the same time periods of dexamethasone mediated induction of GR-LhG4, under the control of the 6XOP promoter using pAtML1::GR-LhG4, in the ap1cal genetic background containing pAtML1::BFP-ER. Q-PCR analysis on extracted RNA confirmed successful sorting and the regulation of known target genes of REV and KAN1 (S7A & S7B Fig). In addition, we also measured gene expression changes using whole ap1cal inflorescence meristems after inducing miRNA165a to knock-down the HD-ZIPIII genes using a two component pAtUBQ10::GR-LhG4/6XOP system (pAtUBQ10>>miRNA165a). For RNA-seq followed by induction of miR165a, we used whole ap1cal SAMs 8 or 16 hrs after induction of the transgene. As a control we induced, pAtUBQ10::GR-LhG4 alone, also in the ap1cal background. Western blotting for REV protein and Q-PCR for REV direct target gene, ZPR3, revealed successful knock-down of REV in the meristem tissue (S7C & S7E Fig). Tables 1, S7, S8 and S9 report the up and down regulated genes at each time point for the RNA-Seq experiments. Known REV regulated genes such as ZPR1, ZPR3, were found to be differentially regulated by REV in both knock-down and ectopic experiments, suggesting overall good data quality. However, fewer differentially expressed genes (DEGs) were identified after miR165a induction compared with the ectopic REV/KAN1 experiment, possibly reflecting the reduced specificity of this experiment (Tables 1 & S9). We therefore focused our remaining analysis on the ectopic expression experiments.
Overall, the majority (81%) of genes that responded to ectopic REV or KAN1 expression were not co-regulated by both transcription factors (S10 Table). However of those genes that were, the largest class corresponded to genes that were co-repressed (54% of co-regulated genes at 6 hrs after induction) (S8A Fig). Consensus clustering of REV and KAN1 DEGs across the two time-points revealed that genes regulated by KAN1 undergo similar changes in expression at both early (6 hrs) and late time points (16 hrs) (Fig 2A). Furthermore, at 16hrs the fold change is more than at 6 hrs, suggesting a stable, accumulating influence of KAN1 on most of its target genes. In contrast, while some clusters of REV DEGs (cluster no. 2, 4, 5, 9) show a similar pattern of change at both time points, many genes (identified in cluster no. 3) were up-regulated at 6 hrs but down-regulated at 16 hrs, revealing both a consistent and as well as dynamically changing influence of REV on downstream gene expression (Fig 2A). Consensus clustering also identified different subsets of genes that are oppositely regulated by REV and KAN1, such as clusters 8, 9 and 10 while other clusters identify genes that are regulated by REV and KAN1 in a similar manner in at least one time point (cluster no. 1, 5, 7) (Fig 2A). GO enrichment analysis indicated “regulation of transcription, DNA-templated” as highly enriched in many clusters, indicating that in the SAM, REV and KAN1 regulate the expression of various transcription factors (Fig 2A, S11 Table), consistent with the results of previous studies on seedlings [12]. GO terms related with meristem function, pattern specification, cell growth and lateral organ development were enriched in clusters of genes repressed by either KAN1, REV or both, apart from cluster 1, which includes genes up-regulated by KAN1. Cluster 3, which includes genes up-regulated by REV at 6 hrs but down-regulated by REV at 16 hrs, was found to be enriched for genes associated with auxin biosynthesis and response. Overall there was significant overlap in the set of DEGs identified in this study with those from previous studies (S12 Table). Included in this overlap were genes belonging to gene families for which several members had been identified previously as REV or KAN1 regulated in seedlings. Such gene families include the BEL1-like homeodomain (BLH), Class II HD-ZIP, INDETERMINATE DOMAIN (IDD), ZINC FINGER PROTEIN (ZFP) and FANTASTIC FOUR (FAF) families of transcription factors as well as auxin-related genes including members of the SMALL AUXIN UP RNA (SAUR), PIN, INDOLE-3-ACETIC ACID INDUCIBLE (IAA), LIKE AUX1 (LAX), YUCCA (YUC) and NAKED PINS IN YUC MUTANTS (NPY) gene families (S9 Fig). However in many cases, additional members of these gene families were found to be DEGs only in this study while other genes within these families were only identified in previous seedling-based studies (S9 Fig). Notably, members of the same gene family often appeared to be regulated similarly. For instance, all differentially expressed members of the BLH family were repressed by either REV, KAN1 or both while the Class II HD-ZIP genes identified are induced by REV and repressed by KAN1. Most members of auxin associated gene families were also repressed by REV or KAN1 or both, although a small minority were induced (S9 Fig). We also identified the hormone cytokinin to be a major focus of both REV and KAN1. For instance, the biosynthetic gene LONELY GUY 7 (LOG7) (AT5G06300), and cytokinin responsive gene ARABIDOPSIS RESPONSE REGULATOR 15 (ARR15) (AT1G74890) were positively regulated by REV in both knock-down and ectopic experiments (S7 & S9 Tables). In contrast, KAN1 acted mainly negatively, regulating the cytokinin biosynthesis genes [ISOPENTENYL TRANSFERASE 7 (IPT7), LOG1, LOG3, LOG7], HISTIDINE KINASEs (HK1, HK3), CYTOKININ RESPONSE FACTORs (CRF1, CRF4, CRF7, CRF10), ARABIDOPSIS RESPONSE REGULTORs (ARR3, ARR4, ARR5, ARR6, ARR15), CYTOKININ OXIDASEs (CKX1, CKX3, CKX4, CKX5, CKX7), KISS ME DEADLY genes (KMD1, KMD3, KMD4), PURINE PERMEASEs (PUP1, PUP4, PUP7, PUP8, PUP10, PUP14, PUP18, PUP21) (Table 2).
Complementary transcriptomics approach identifies cell-type specific genes responsive to REV and KAN1
Having identified genes differentially expressed in the SAM REV, KAN1 and BFP-only epidermal expression domains as well as genes differentially expressed in response to perturbations of REV and KAN1 expression in the SAM epidermis, we proceeded to analyse the overlap between the two data sets. Firstly, we investigated whether any of the sets of genes clustered by their response to REV and KAN1 perturbations, were preferentially expressed in specific cell types. We found this to be the case for several clusters including clusters 11, 15, 6, 12, 13, 4, 14, based on a 1.5-fold cut off. For instance, cluster 11, which represents genes repressed by both REV and KAN1 were on average more highly expressed in BFP-only cells where REV and KAN1 expression is absent (Fig 2B). This cluster is enriched for genes involved in organ formation such as AINTEGUMENTA (ANT), PRESSED FLOWER (PRS), SAWTOOTH 1 (SAW1) and ROTUNDIFOLIA 3 (ROT3), consistent with the finding that ectopic expression of REV and KAN1 represses organogenesis [4]. Genes in clusters 6 and 12 also exhibited reduced expression in the KAN1 domain while cluster 15 shows reduced expression in the REV domain. Correspondingly, clusters 6 and 12 represent genes repressed by KAN1 while cluster 15 represents genes repressed by REV (Fig 2A). The average expression level of genes in Cluster 10 was slightly higher in KAN1 expressing cells in comparison to the other cell types and consistent with this, this cluster represents genes up-regulated by KAN1. Genes in Cluster 4 are repressed by KAN1 (Fig 2A) and consistent with this, the average expression level of Cluster 4 genes is lower in the KAN1 domain compared to BFP-only domain (Fig 2B). Perhaps surprisingly, genes in Cluster 14, which represents genes repressed by REV at 16 hrs also represents genes that are more highly expressed in the REV domain. Genes in this cluster include DNA BINDING WITH ONE FINGER (DOF) 5.3 (also called TARGET OF MONOPTEROS 6), DOF6 and DOF2.4, which are genes also known to be expressed in vasculature [23]. Since long-term ectopic expression of REV represses organogenesis, the repression of these vascular expressed genes is most likely an indirect consequence of this phenotype.
In addition to comparing the average expression levels of specific clusters in different cell types, we also investigated the cell type specific gene expression patterns of genes responsive to REV or KAN1 (Fig 2C). Overall, we found that the majority of genes regulated by REV or KAN1 within 6 hrs, show a cell type specific expression pattern although this was true for a lower percentage of genes regulated at 16 hrs after induction (S13 Table). As might be expected, the set of genes repressed by REV at 6 hrs is made up of a large proportion (82%) of genes that are usually expressed at lower levels in the REV domain. This compares to a lower proportion (62%), if considering the set of all genes found to be differentially expressed in response to REV/KAN1 perturbations (1st bar in Fig 2C). Similarly, around 80% of genes repressed by KAN1 at 6 hrs are differentially expressed at higher levels outside the KAN1 domain compared to 55% for all REV/KAN1 DEGs. For genes up-regulated by KAN1 at 6 hrs, around 70% are expressed at higher levels in the KAN1 domain (compared to 45% for all REV/KAN1 DEGs) (Fig 2C). However, for genes induced by REV at 6 hrs, 75% were found to be differentially expressed at higher levels outside the REV domain (compared to 64% for all REV/KAN1 DEGs). This percentage dropped to around 50% for genes induced by REV after the longer interval of 16 hrs (Fig 2C). We note that this finding is consistent with the characteristics of genes in Cluster 3 (i.e. Cluster 3, Fig 2A), which are initially upregulated by ectopic REV expression, but then subsequently repressed and under normal conditions more highly expressed in the KAN1 and BFP-only domain compared to the REV domain (Fig 2B). Analysis of the overlap reveals 304 out of the 862 genes in cluster 3 are differentially expressed at higher levels outside the REV domain compared to 106 of them that are expressed more highly within it. Genes related to glucosinolate metabolic processes and defense response were found to be enriched in this set of 304 genes (Fig 2A and S14 Table). Glucosinolates play an important role in defense against pathogens and Indole-glucosinolates (IGs) and Indole-Acetic Acids (IAAs) are synthesized from the common precursor tryptophan. It has also been shown that changes in IG levels in plant cells affects IAA concentrations [24, 25], suggesting the possibility that these genes may be transiently and indirectly up-regulated by REV to maintain auxin homeostasis. To check this possibility, we selected thirteen genes from this cluster and analysed their expression levels by qPCR after induction of p35S::GR-REVd in the presence and absence of the protein synthesis inhibitor cycloheximide. As shown in S10 Fig, although most of the genes were confirmed to be induced by REV, in the presence of cycloheximide treatment most genes remained uninduced confirming indirect regulation.
Cell type specific genes induced 16hr after REV induction are predominantly expressed in the REV and BFP-only domain
Of the genes which are induced 16 hr after induction of REV, many are expressed at higher levels in both REV and BFP-only cells (Fig 2C). Furthermore, from this overlapping gene set, the majority (47 out of 58) are also repressed by KAN1 (S15 Table). This set includes known REV targets such as the Class II HD-ZIP genes (HAT3, HAT9, HAT22) and LITTLE ZIPPERs (ZPR1, ZPR3, ZPR4) [14, 26] and known KAN1 targets such as ASYMMETRIC LEAVES 2 (AS2) [27], as well as genes involved in meristem maintenance (SEPALLATA 4/AGAMOUS-LIKE 3, CAULIFLOWER/AGAMOUS-LIKE 10, WUSCHEL, BELL1, HOMEOBOX GENE 1(ATH1), DORNROSCHEN, LOG7, ARR15), axillary meristem initiation (REGULATOR OF AXILLARY MERISTEMS 1 (RAX1)), establishment dorsal cell identity (AS2, ZFP8, GLABRA 1 (GL1), TRANS-ACTING SIRNA 3 (TAS3), BLADE ON PETIOLE 1 (BOP1), BOP2) and promotion of auxin biosynthesis and transport (IDD15, ANT-LIKE 5). Auxin responsive genes in this group that also promote organ development include DORNROSCHEN, NPY1 and SHI-RELATED SEQUENCE 7 while other early auxin-responsive genes include IAA30 and SAUR41, which remain to be characterized (Table 3, S16 Table).
Genes down-regulated by REV and excluded from the REV domain correspond to genes responsive to auxin and genes that promote ventral identity
Genes down-regulated by REV and differentially expressed at higher levels outside the REV domain include many genes involved in specifying ventral cell identity, such as KAN1, KAN2, KAN3, YABBY1 [FILAMETOUS FLOWER (FIL)], YABBY2, YABBY3, miRNA166A (Table 3, S16 Table). While negative regulation of the KAN genes and miRNA165/166 by REV has been reported previously [28], the finding that FIL is also repressed by REV is consistent with previous data showing that the expression of a fluorescent reporter for FIL expression becomes complementary to REV domain during leaf initiation [4] and that FIL is not expressed in the dorsalized leaves of phb-1d [29]. Additionally, this group of genes contains many auxin-responsive gene families such as 6 IAA genes (IAA1, IAA2, IAA4, IAA14, IAA17, IAA19), 4 class I HD-ZIPs (ATHB5, ATHB12, ATHB23, ATHB31), 6 GRETCHEN HAGEN 3 (GH3) genes (GH3.2, GH3.3, GH3.5, GH3.6, GH3.12, GH3.17), 2 SAUR genes (SUAR42, SAUR79), BELL family genes (BLH3, BLH5) and genes involved in auxin transport (PIN3, PIN7, PINOID2, PINOD BINDING PROTEIN 1) (Table 3, S16 Table). These results support the recently proposed role of REV in repression of auxin signaling [4].
Genes up-regulated by KAN1 in the KAN1 expression domain
This group includes three GH3 genes (GH3.2, GH3.3, GH3.4), SAUR5, SAUR69 and PIN7 (Table 3, S16 Table). GH3 proteins function as IAA-amido synthases that conjugate Ala, Asp, Phe, and Trp to auxin. Mutant plants carrying insertions in these genes are hypersensitive to auxin, suggesting that these genes work as negative regulators of auxin abundance [30].
Genes down-regulated by KAN1 and excluded from KAN1 domain
As mentioned above, many genes in this category are also up-regulated by REV. Evidence that KAN1 represses these genes independently of REV comes from the finding that REV itself was not found to be repressed by KAN1 within the 16 hrs time period. However by 6 hrs we detect down-regulation of PHABULOSA (PHB) (S8 Table) indicating that the repression of these genes by KAN1 may still occur indirectly via the repression of HD-ZIPIII genes. The genes not regulated by REV but repressed by KAN1 can be divided into two groups based on their expression pattern: The first group is enriched for genes expressed in REV cells and included in this group are many genes involved in meristem maintenance and organogenesis, such as CLAVATA3 (CLV3), CLV3 RELATED genes (CLE16, CLE43), WOX9/STIMPY, Class II KNOTTED1-LIKE HOMEOBOX genes (KNAT4), ARGONAUTE (AGO) genes (AGO7, AGO9, AGO10), LATERAL ORGAN FUSION 1 (LOF1), JAGGED LATERAL ORGANS (JLO) (Table 3) [31–37], consistent with a repressive for KAN1 in meristem development. Other genes in this subcategory include genes involved in floral organ specification and growth (UNUSUAL FLORAL ORGANS (UFO), NGATHA3, SHORT INTERNODE (SHI) NO TRANSMITTING TRACT (NTT)) [38–42], auxin transport (PIN1, PIN4, PIN-LIKES3, AUX1, LAX1, phospholipase D P2 [43–46], genes involved in lateral organ development and patterning such as AGAMOUS, GL3, NGATHA1, PETAL LOSS, STYLISH 2, SAW1/BLH2, SAW2/BLH4, BLH1, LOB [47–53] and genes involved in auxin synthesis and signaling (YUC1, IAA7, AUXIN RESPONSE FACTOR 6 (ARF6)) [54–56] (Table 3, S16 Table).
Cell type expression analysis of co-repressed targets
In total, 2275 genes in pAtML1>>REVr-2VENUS and 4699 genes in pAtML1>>KAN1-2GFP line were found to be differentially expressed (S7 & S8 Tables) and of these, 1090 genes were common between them (S10 Table). At 6 hrs after induction, 54% of these common targets were co-repressed compared to 35% oppositely regulated while at 16 hrs, both co-repressed and oppositely regulated genes are equally represented (47% each) (S8A & S8B Fig, S17 & S18 Tables). Of the 492 genes that are co-repressed at either one of the two time points, (S10 Table), 199 (40%) are expressed more highly in BFP-only cells. Of these, 86 were found to be expressed exclusively in BFP-only cells, 35 relatively highly in both REV and BFP-only cells, and 78 genes were expressed relatively highly in both KAN1 and BFP-only cells (S10 Table). Co-repressed genes expressed exclusively in the BFP-only domain include genes involved in lateral organ outgrowth including FIL, PRS, LONGIFOLIA 2 and LATERAL SUPPRESSOR (LAS), (S19 Table) [57–59]. Other genes in this category include genes involved in cell-wall modifications, such as PEROXIDASE CA, EXTENSIN 4, PECTIN ACETYLESTERASE 9 and PECTIN METHYLESTERASE INHIBITOR 9. Genes enriched in both BFP-only and REV cells include genes involved in organ initiation such as ANT and ANT-LIKE 7, meristem organ boundary specification, such as CUP SHAPED COTYLEDON (CUC) 1 and CUC3 and hormone degradation including GIBBERELLIN 3-OXIDASE 3, CYTOKININ OXIDASE 4 and BRASSINOSTEROID-6-OXIDASE 2) (S19 Table). Genes enriched in both BFP-only and KAN1 cells include YABBY2, YABBY3, KNAT1 a class I KNOX gene and its target involved in cytokinin biosynthesis IPT7, a negative regulator of cytokinin signaling (KISS ME DEADLY 1), known auxin responsive genes (IAA14, SAUR42) and Class I HD-ZIP transcription factors ATHB12 and ATHB23 (S19 Table).
To validate our results, we measured the expression of some of the identified REV/KAN1 targets using Q-PCR in plants expressing p35S::GR-REVd and p35S::KAN1-GR, separately after dex induction (Fig 3). Q-PCR confirmed that REV and KAN1 repress the middle domain genes WUSCHEL RELATED HOMEOBOX (WOX)1 and PRS/WOX3 (Fig 3B and 3C). Cyclohexamide treatment did not alter this result revealing that KAN1 directly represses both of these genes, whereas REV directly represses WOX1, and indirectly represses PRS (Fig 3B and 3C). In another independent Q-PCR, in which we sorted cells after induction of pAtML1>>REVr-2VENUS, PRS expression was repressed by REV but no effect was observed on WOX1 expression (Fig 3A), which is consistent with the observation that WOX1 is not expressed in the SAM [4]. Q-PCR experiments also confirmed indirect repression of the primordial genes ANT and FIL by REV, although the effect on FIL expression was statistically less significant (p<0.1). No effect of KAN1 on FIL or ANT was detected by Q-PCR.
All together our results identify many prominent genes known to play a role in organ development as responsive to REV/KAN1 that were not identified as such previously. Furthermore, in many of these cases, several related family members were also identified. For instance multiple members of the BOP, KNAT, BARELY ANY MERISTEM (BAM), CUC, ANT-like, YABBY, SEPALLATA, ARGONAUTE, MADS, GLABRA, NGATHA, DORNROSCHEN (DRN), RAX, TRANS-ACTING siRNA and STYLISH gene families were identified as regulated by REV or KAN1. The vast majority of these genes were found to be repressed by KAN1 at either 6 hrs or 16 hrs after induction but many of them are also repressed by REV at the later 16 hr time point (S16 Table), consistent with the repression of organogenesis caused by ectopic expression of either REV or KAN1 [4]. We also noticed extensive regulation of cytokinin signalling related genes by REV and KAN1, some of which are expressed in domains resembling those of REV and KAN1. For instance, our data indicate that KAN1 promotes PUP4 expression and that PUP4 is expressed in KAN1 domain in the shoot. Other PUP genes are expressed in a similar pattern (S16 Table), including PUP14 which acts to repress cytokinin signalling by depleting cytokinin in the apoplast [60]. Thus, we would expect cytokinin signalling to be repressed in the peripheral KAN1 meristem domain. In contrast, REV likely promotes cytokinin synthesis by upregulating LOG3 and LOG7 expression suggesting antagonistic regulation of meristem function by these genes through opposing roles in cytokinin signalling. In addition to identifying characterised genes, we also found a large proportion (27–42%) of REV/KAN1 DEGs that remain to be characterised. Some of the more predominant gene families in this class based on database annotation encode GDSL-motif esterases, major facilitator superfamily proteins, homeodomain containing proteins and zinc finger containing proteins.
Transcriptome analysis of auxin induced organogenesis in the shoot
Previous findings indicate both the HD-ZIPIII and KAN repress the formation of new lateral organs. Since organ formation is dependent on auxin-induced transcription [3, 61, 62], these observations suggest that HD-ZIPIII and KAN activity may repress auxin-induced transcription [4]. Further data supporting this proposal comes from findings that ARF3 and ARF4 work in conjunction with KAN1 and KAN2 to repress the formation of ectopic outgrowths from leaves [5]. To test this proposal further, we decided to investigate the regulatory relationship between KAN1, REV and auxin-induced gene expression in the SAM. We first identified genes involved in auxin-mediated organogenesis by applying auxin paste to pin1 mutant meristems, which promotes organ outgrowth from the SAM periphery [1]. We then performed RNA-Seq using RNA extracted from pin1 mutant meristems 30 min, 4hr, 12hr and 16hr after auxin application. As shown in Fig 4A, at 30 min after auxin application, most DEGs are up-regulated (318 up against 34 down), indicating that auxin mainly acts as a transcriptional activator. However at later time points, the proportion of up-regulated genes decreases and at 16 hr after auxin application, down-regulated genes outnumber up-regulated genes (Fig 4A). Of the 318 early auxin induced genes identified at 30 min after auxin application, 53 genes exhibited a log2 FC >2 and 36 of these have been previously characterized according to the TAIR database (www.arabidopsis.org) (S20 Table). Additionally we compared these 318 genes with publicly available microarray data [63–65] obtained after IAA application on seedling tissue and we found around 20% overlap (S21 Table). To identify sets of similarly regulated genes we used hierarchical clustering (Fig 4B and S22 Table). GO enrichment analysis of these clusters identified biological processes affected by our auxin treatment (Fig 4C and S22 Table). Two clusters (cluster no. 1 and 8), which represent genes up-regulated at all time points, show enrichment of the GO terms response to auxin, auxin activated signaling pathway, and auxin metabolic processes, indicating that these biological processes remain active over the term of the time course. Cluster 2, which contains genes weakly down-regulated at 30 min and up-regulated at later time points, shows enrichment of GO terms DNA metabolic process, DNA repair, cell cycle, cellular component organization, meristem development, anatomical structure development and pattern specification process, consistent with expected growth and patterning in response to the auxin treatment. Genes repressed at all time points show enrichment of the GO terms response to chemical (cluster no. 4), photosynthesis, response to cytokinin and response to abiotic stimulus (cluster no. 7). Genes strongly repressed at 12 and 16 hrs in cluster no. 10 and 11 are enriched for genes associated with the GO terms glucosinolate metabolic process and indole-containing compound metabolic process, respectively.
The expression of auxin regulated genes is not confined to a particular cell type
We next asked whether the expression patterns of identified auxin-regulated genes are specific to particular cell types based on our FACS data. We found that around 60% of genes regulated by auxin at 30 min in pin1 mutant apices are differentially expressed according to cell type (Table 4). Their overall patterns of expression resembled those found for all genes identified to be differentially expressed according to cell type (Fig 5A). This is somewhat surprising since the DR5 auxin response reporter is restricted spatially in its response to auxin [4, 7, 8]. One likely explanation is that these genes are regulated by other factors in addition to auxin. In contrast, more than 70% of genes up-regulated by auxin at later time points (4 hr and 12 hr) are most highly expressed in the REV domain (Fig 5A). This set includes many cell cycle related genes (Histones, Cyclins, Kinesins, as well as genes involved in other cell cycle related processes), genes involved in floral organ initiation including ROXY1, STYLISH 1, SHI-RELATED SEQUENCE 7, ANT-LIKE 6, TMO6 and DORNROSCHEN-LIKE (DRNL), genes involved in organ polarity (PHABULOSA, ZPR3, ZPR4) and two IAA genes (IAA29, IAA30) which lack domain II required for their degradation in presence of auxin (S23 & S24 Tables). Lastly, auxin responsive genes which are up-regulated at 16 hr are over-represented in the set of genes most highly expressed in the BFP-only and BFP-only and REV domain (Fig 5A). This set includes genes involved in establishing the meristem-organ boundary (CUC2) as well as genes promoting abaxial identity (YABBY1/FIL) (S23 & S24 Tables).
Genes regulated by auxin are regulated by REV and KAN1 in diverse ways
Previous studies have suggested a role for KAN1 in the repression of auxin biosynthesis, transport and signalling [4, 9–11, 13]. This conclusion was based on either phenotypic analysis or transcriptomics data reporting the repression of auxin regulated genes by KAN1. For instance, [9,10,13] found that KAN1 repressed the expression of PIN1 and other related genes encoding auxin transport proteins as well as genes involved in the regulation of these transporters, such as PID and NPY-related genes. Other auxin-related genes already identified to be repressed by KAN1 include members of the Aux/IAA and ARF gene families as well as genes involved in auxin synthesis including YUC and TAA family members. In this study, which focuses on the shoot, we also found many of the same auxin-associated genes to be repressed by KAN1 (S16 Table). In addition, we also provide evidence that many of these genes are expressed at comparatively low levels in the KAN1 SAM domain, as would be expected if KAN1 usually represses these genes during normal development. As for regulation by KAN1, around two thirds of all DEGs regulated by KAN1 6 hrs after induction are repressed and this proportion is similar for the genes in this set that are also induced by auxin at 30 mins (Fig 5B). However for later auxin-regulated genes in this set, e.g. 4 and 12 hrs, this proportion increases, e.g. 78% for 4 hr auxin-induced genes. Genes in this category include genes involved in organ formation such as, YABBY1/FIL (AT2G45190), ANT-LIKE 6 (AT5G10510), STYLISH1 (AT3G51060), STYLISH2 (AT4G36260), SHI (AT5G66350), ROXY1 (AT3G02000), BOP1 (AT3G57130), BOP2 (AT2G41370), DRNL (AT1G24590), MONOPTEROS (AT1G19850), ZPR3 (AT3G52770), PHB (AT2G34710), and genes involved in auxin transport such as PIN1 (AT1G73590), AUX1 (AT2G38120), LIKE AUXIN RESISTANT 2 (AT2G21050) (S21 Table), consistent with previous data demonstrating that KAN1 represses auxin transport and organogenesis [4]. For genes regulated by KAN1 at 16 hrs after induction again, most are down-regulated (70%). However this response is reversed for genes in this set that are responsive to auxin at 4 hrs (62% up-regulated). Key genes in this category include GH3 related genes (AT4G37390, AT2G23170), which are known to conjugate auxin to amino acids [30], IAA29 (AT4G32280), a known repressors of auxin‐regulated transcription [66, 67] and HISTIDINE PHOSPHOTRANSFER PROTEIN 6 (AT1G80100) (S21 Table), which is a negative regulator of cytokinin signaling. This response therefore suggests that apart from repressing positive regulators of auxin-induced organ growth, KAN1 also indirectly activates genes that nevertheless, also repress pathways that promote organogenesis.
With regard to REV, previous transcriptomics results suggest a role in promoting auxin biosynthesis, transport and signalling [10, 14]. In contrast, detailed analysis of loss of function and ectopic expression induced phenotypes suggest that REV and other HD-ZIPIII genes act to repress auxin transport and signalling [4, 68]. With respect to genes induced by auxin within 30 mins, our results indicate that a higher proportion of these genes are upregulated by REV at 6 hr compared to all REV DEGs (Fig 5B). Interestingly of the 47 30 min auxin response genes upregulated by REV at 6 hrs, 34 are also downregulated by REV at 16 hrs and of these 34, half (17) belong to cluster 3 from Fig 2A providing further evidence that REV regulates genes associated with auxin response in opposite ways, depending on the time after REV induction.
As discussed above, many of these genes promote glucosinolate production. Other genes transiently upregulated by REV prior to their repression include genes involved in glutathione regulation (Fig 2A). Since both glucosinolates and glutathione are regulated in response to abiotic stress [69], it is possible that transient induction of these genes by REV represents a secondary consequence triggered by stress. However our data also indicates that these genes are normally expressed at relatively low levels in the REV SAM domain compared to the KAN1 domain, consistent with their longer-term repression by REV (S16 Table). This suggests a developmental role for these genes although the exact nature of this role remains unclear. In contrast to this subset of genes, the majority of auxin-regulated genes also regulated by REV at 16 hrs are repressed (Fig 5B), especially genes regulated by auxin after 4 hrs (92%), and include genes involved in organ formation such as YABBY1/FIL, ANT-LIKE 6, STYLISH1 and ROXY1 (S11 Fig, S24 Table). Thus these results are consistent with previous results showing that in the SAM, REV represses auxin-dependent organogenesis [4]. Although ultimately repressed by REV, many rapid auxin-induced genes as well as genes slower to respond to auxin, are normally co-expressed with REV according to our data. Although somewhat counterintuitive, this is consistent with the finding that REV itself is indirectly induced by auxin and that its expression domain expands into PIN1 polarity convergences sites soon after their appearance [4].
Overall our data indicate that both REV and KAN1 regulate downstream genes, including auxin-induced genes, in a cell type and gene-specific manner with REV acting to both activate and repress some auxin-regulated genes in a temporally dynamic but indirect fashion. This mode of action appears to contrast with that of WUS, which more directly represses general auxin response in the meristem central zone [70]. Unlike loss of KAN or HD-ZIPIII function however, loss of WUS function does not result in ectopic organogenesis suggesting that the HD-ZIPIII and KAN genes repress organogenesis by acting on specific auxin-regulated targets or pathways and/or by regulating other organogenesis-related genes not associated with auxin. While our study leaves open the question of which genes are involved in such pathways, this work identifies many promising candidates for future investigation.
Materials and methods
Plant materials and growth conditions
Plants were grown in soil under continuous light at 22 degrees C. Transgenic Arabidopsis thaliana plants were generated by Agrobacterium-mediated transformation. To generate triple marker line for cell-sorting experiments, pBGW-pREV::REV-2YPET;pKAN1::KAN1-2GFP construct was introduced into plants containing pMOA33-pAtML1::mTag-BFP-ER in ap1cal background. To identify downstream targets of REV and KAN1, pSult-pAtML1::GR-LhG4;6OP::REVr-2VENUS, and pSult-pAtML1::GR-LhG4;6OP::KAN1-2GFP were separately transformed into ap1cal plants. pBart-pAtML1::GR-LhG4 was introduced into in ap1cal plants which were containing pMOA33-pAtML1::mTag-BFP-ER, to use as a control for RNA-Seq studies involving ectopic expression of REV or KAN1. For knocking-down REV for RNA-Seq experiments, pAtUBQ10::GR-LhG4;6OP::miRNA165a construct was introduced in ap1cal background. pSult-pAtUBQ10::GR-LhG4 in ap1cal background was used as a control for experiments in which RNA-Seq was done after induction of pAtUBQ10::GR-LhG4;6OP::miRNA165a. pin1 mutants (also known as pin1-613, pin1-7, SALK_047613) [8, 71] used for RNA-Seq studies were obtained from the European Arabidopsis Stock Centre (NASC). p35s::GR-REVd and p35s::KAN1-GR seeds were a gift from Stephan Wenkel (Copenhagen Plant Science Centre). rev-1 and rev phb phv mutant plants are described in [72] and [73] respectively.
Constructions of recombinant DNAs
For construction of pBGW-pREV::REV-2YPET;pKAN1::KAN1-2GFP construct, pREV::REV-2Ypet and pKAN1::KAN1-2GFP [4] transgenes were combined in T-DNA vector pBGW [74] by Gateway technology (Invitrogen). For pMOA33-pAtML1::mTag-BFP-ER construct, ER-localized mTag-BFP [20] was synthesized (Genscript) and cloned as a BamHI fragment downstream of 3.4 kb of the L1-specific ATML1 gene (At4g21750) promoter in pBJ36 vector, and then whole expression cassette was transferred into T-DNA vector pMOA33 [75] through NotI restriction digestion and ligation. Construction of pSult-pAtML1::GR-LhG4;6OP::REVr-2VENUS and pSult-pAtML1::GR-LhG4;6OP::KAN1-2GFP is explained in [4] and pAtUBQ10::GR-LhG4;6OP:mir165a is explained in [28]. Constructions of pAtML1::GR-LhG4 and pAtUBQ10::GR-LhG4 drivers is described in [4], and these drivers were eventually transferred into the T-DNA vector pSULT through NotI restriction digestion and ligation [4].
Dexamethasone treatment of inflorescence meristems
For inducible gene perturbations in the IM, 10 μM DEX solution containing 0.015% Silwet L-77 was applied once to the IM and tissues were collected after required time point for RNA-Seq experiments. For analysing phenotype, the DEX was applied every second day for total 7 days. Inflorescences were then dissected and imaged.
Protoplasting
Buffer A (10mM KCl, 2mM MgCl2, 2mM CaCl2, 0.1% BSA, 2mM MES hydrate, 0.6M Mannitol) was filter sterilized and stored at 4°C for long term use. 1.5% Cellulase RS 10 (ONOZUKA, Yakult Pharmaceutical, Japan) and 0.1%Pectolyase Y23 (Kyowa chemical products co. Ltd., Japan) were dissolved into required amount of buffer A by mixing in rotating wheel in dark at 4 degree. About 50 young SAMs of 4–5 week old ap1cal plants containing transgenes were quickly harvested and placed in enzyme solution in 70um cell-strainer in a small petridish. After that, the SAMs were chopped into small pieces through sharp blade and incubated in dark at 22°C for 60 minutes on a bench top orbital shaker at 100 rpm. At every 20 minutes, the cell strainer was lifted up and the SAMs were gently pressed against the cell strainer using an autoclaved pestle. The gentle pressing enabled the tissue to loosen and disperse. After that, protoplasts suspension was carefully transferred from the tissue culture dishes to the 15 ml round bottom falcon tube. From this point onwards the protoplasts were kept on ice. The protoplasts were collected by centrifuging at 500g for 7 minutes at 4°C. The supernatant was carefully removed without disturbing the protoplast pellet. To wash the pellet, it was resuspended gently in 5 ml of Buffer A by pipetting. Resuspended protoplasts, were centrifuged at 500 g for 7 mins at 4°C. The supernatant was discarded and the pellet was resuspended in 1 ml of Buffer A. The resuspended pellet suspension was passed through the 40 um cell strainer in a small petri dish and was used for sorting through Fluorescence Activated Cell Sorter (FACS).
FACS
Samples were sorted by the EMBL flow cytometry core facility using a special setup MoFlo XDP cell sorter from Beckman Coulter equipped with a Coherent Sabr Argon gas laser emitting at 514.5nm (400mW), a Coherent Innova gas laser emitting at 488nm (300mW), and a Coherent Obis 405nm solid state laser (240mW). Forward-(FSC)/side scatter(SSC) and eGFP signals were taken from the 488nm laser (FSC/SSC both 488/10nm band-pass, 505 DCSP beam-splitter; eGFP 510/20nm band-pass + 514nm notch filter). YFP and propidium iodite (PI) signals were recorded from the 514.5nm laser (YFP 545/35nm band-pass + 514nm notch; 605 DCSP beam-splitter; PI 630/40nm band-pass). BFP signals were taken from the 405nm laser (440/40nm band-pass). Spectral overlap was minimal and hence no compensation was necessary. Doubled gating was based on SSC height vs area ratios. For all sorts, FACSFlow (BD) was used as sheath fluid at 30psi and protoplasts were sorted with a 100um nozzle at a frequency of 40kHz. For RNAseq library preparation, 100,000 viable protoplasts were sorted directly into 500 ul RLT buffer (Qiagen) while sample and receptacle cups were kept at 4°C during the whole sort and then immediately shock frozen in liquid nitrogen.
RNA-extraction and validation
The frozen protoplasts were thawed at 37 degree and then RLT buffer volume was adjusted to 3:1 to volume of protoplasts. After mixing it by vortexing, the mixture was incubated at room temperature for 5 minutes, and then again vortexed vigorously to break down the protoplasts. After that Rneasy Mini kit (Qiagen) was used according to manufacturer’s instruction. An aliquot of RNA was used to check quality and quantity through 2100 Bioanalyzer (Agilent). Another aliquot was used for cDNA preparation using Super script III reverse transcriptase for Q-PCR analysis. Q-PCRs were performed in a StepOne Plus Real Time PCR system thermo cycler (The applied bio systems) using 20μl of PCR reaction contained 10 μL of SYBR Green mix (Roche), 1μl of primer mix (10um), 2μl of diluted cDNA and 7 μl of water. Sequence of primers used is given in S25 Table. Transcript levels were normalized to ACTIN2 transcript levels. Data was analysed using the 2−ΔΔCT method.
Library preparation
RNA-Seq Libraries for all cell-type experiments and pin1 mutants were prepared with minimum of 10ng of RNA using ‘NEBNext Ultra RNA Library Prep Kit for Illumina’. For pAtUBQ10>>miRNA165a SAM tissue, the libraries were prepared with 1μg of total RNA using ‘TruSeq Stranded mRNA Library Prep Kit from Illumina’.
Data quality control and sequence alignment
The quality of the sequencing data was assessed using FastQC [76]. PCR primers, bad quality bases (with a Phred score <20) and bases with fluctuating GC content were trimmed off with cutadapt [77]. Genome mapping was performed using TopHat [78], using an index generated from TAIR 10 genome release.
Differential expression
A gene expression count table was generated from the aligned dataset using HTSeq [79] using TAIR 10 gene annotations and using only the exonic regions of the gene. Differential expression analysis was done using DESeq2 [80] R package and all the genes with an adjusted p-value of < = 0.1 and an absolute log2 fold change of > = 1 were considered as differentially expressed. These set of genes were used in further downstream processing.
GO enrichment
GO enrichment analysis was performed using topGO [81] Bioconductor package and using “molecular function” Gene Ontology annotations for A. thaliana. The list of over-represented GO terms were filtered down using the criteria: p-value cut-off: 0.05, minimum number of over represented genes: 5, minimum number of annotated genes: 5
Clustering
The list of differentially expressed genes from various experiments were clustered based on log2 fold change values using a clustering technique called consensus clustering [82]. In the first step, quantile normalized log2 fold changes were clustered using k-means clustering. In this step, the number of clusters (k), and the total number of genes (n) were sampled randomly. For k, the sampling range was 3 ≤ k ≤√n, while n was resampled with the criteria that the resampled n should not be less than 80% of the total number of genes. For each k-means run, maximum number of iterations and the number of random restarts were set to 500 and 20 respectively. This first step was iterated for 4000 times, and the clustering consensus (similarity) between two genes in the input list was calculated as:
similarity = Nr. of times two genes appear in the same cluster / Nr. of times two genes were sampled together
This consensus clustering matrix was filtered down to exclude genes with a very weak similarity. This filtering was done using personalized page rank algorithm [83] to model the clustering consensus between a given gene and its neighbours. In this step, each gene was selected as the starting node and personalized page rank was computed for rest of the genes in the consensus matrix. These page rank values were sorted and top 65% of a genes’ neighbours were retained in the consensus matrix. In the final step of the clustering process, the filtered consensus matrix was clustered using Infomap clustering algorithm [84] implemented in igraph R package [85] with the number of random trials parameter was set to 1000.
Western blot
Total proteins were extracted from 5 days old seedling tissues of rev-1, Col-0 and rev phb phv triple mutant in protein extraction buffer (400m M sucrose, 50m M Tris-Cl pH 7.5, 10% glycerol, 2.5 mM EDTA). The protein extract was transferred to fresh 1.5 ml tube and centrifuged at 13000 rpm for 5 min to pellet down the debris. The supernatant was transferred to a fresh 1.5 ml tube, and an aliquot of 2 ul was taken out in a separate tube for the estimation of protein concentration by Bradford assay. To the 50 ug of total protein, appropriate amount of 6x of sample loading buffer (200 mM Tris-Cl, pH 6.8, 400 mM dithiothreitol, 4% SDS, 0.025% Bromphenol Blue, 20% glycerol) was added and boiled for 5 min before loading on SDS-PAGE. Proteins were then transferred to Hybond ECL nitrocellulose membrane (GE Healthcare) at 100 mA for 1 hr in transfer buffer (Tris (7.56 g), glycine (47 g), 20% methanol in 2.5 liters) in Mini blot protein gel apparatus (GE Healthcare). The membrane was then incubated for overnight in 10 ml of blocking buffer (5% non-fat dry milk in Tris-buffered saline and 0.05% Tween 20) at 4 degree C with shaking. The blocking reagent was removed, and the affinity-purified primary antibody (Anti-REV) diluted (1:1000) in 10 ml of blocking buffer with 0.05% Tween 20 was added and incubated for 2 h with shaking at room temperature. The membrane was then washed with 10 ml of wash buffer (Tris-buffered saline and 0.05% Tween 20) for thrice, 5 min each. The secondary antibody, conjugated with horseradish peroxidase diluted (1:10,000) in 15 ml of blocking buffer with 0.05% Tween 20, was added and incubated for 1 h with shaking at room temperature. The membrane was washed with 15 ml of wash buffer for five times at room temperature. The working solution of substrate was prepared by mixing peroxide solution and luminol/enhancer solution in 1:1 ratio, and the blot was incubated in that working solution for 5 min. The blot was then removed from the working solution and covered with plastic wrap in a cassette and exposed to x-ray film for different times.
Dexamethasone and Cycloheximide treatment for Q-PCR
The Q-PCR results shown in Fig 3 are obtained from 4 days seedling tissues of p35s::GR-REVd and p35s::KAN1-GR lines in wild-type (Ler) background. For Q-PCR results shown in S10 Fig, SAMs from transgenic line containing p35s::GR-REVd in ap1cal background were used. Whole seedlings (for seedling experiment) or whole shoots (for ap1cal SAMs) were immersed in solutions containing 10 μM dexamethasone in 0.1% ethanol or 0.1% ethanol (mock) or 10 μM dexamethasone + 20 μM cycloheximide or 0.1% ethanol (mock)+ 20 μM cycloheximide solutions. Seedling tissues were treated for 3 hrs and SAMs were treated for 2 hrs. After that vegetative meristem and first pair of leaves were dissected and collected from seedlings tissues, whereas SAMs were collected from ap1cal line containing p35s::GR-REVd. Three biological replicates were collected for each treatment, each line and each tissue type. RNA extraction from seedling tissue was done using RNeasy Mini kit (Qiagen) following manufacturer’s instruction, whereas ISOLATE II RNA Mini kit (Bioline) was used for RNA extraction from SAM tissue. SensiFAST cDNA Synthesis Kit (for SAM tissue) and Super script III reverse transcriptase (for seedling tissue) were used for cDNA synthesis. Q-PCRs were performed in a StepOne Plus Real Time PCR system thermo cycler, Applied Bio Systems (ABI) (for seedling tissue) and LightCycler 480 II, ABI (for SAMs) according to the manufacture’s instructions. Sequence of primers used is given in S25 Table. Transcript levels were normalized to ACTIN2 transcript levels. Data was analysed using the 2−ΔΔCT method.
Validation of spatial expression patterns of selected DEGs in SAM
pREV::REV-2YPET;pPIN1::PIN1-CFP transgenic line has been previously described [4]. For preparing DNA constructs for validation of spatial expression patterns of AT5G20740, AT1G71520 and AT3G04290 genes, full-length promoters of these genes were amplified using infusion primers (AT5G20740 FP- GCGGCCGCATGCATATGCTTACTTTTACTACGATTACGAGGAGATTG, AT5G20740 RP- TGTTGGATCCAAGCTTTATCTCTCGGGTTAGAGTAAGAGACC; AT1G71520 FP- GCGGCCGCATGCATATGACTATATAGTCTTCATTTCTATTCATTTCTATTCATTTTATG, AT1G71520 RP- TGTTGGATCCAAGCTTGTTTTTGGGTGGATGAAGATGAGATTA; AT3G04290 FP- GCGGCCGCATGCATATGGGAGTAGTTGGTCTGCATGTGTATG, AT3G04290 RP-TGTTGGATCCAAGCTTTGTTATGGACAGAGAATGGGACTAGAT). These promoters were then individually cloned in front of NLS-TdTomato in pBJ36 vector through infusion cloning after digesting the vector with BamHI. Later whole expression cassette containing promoter::NLS-TdTomato-pea3A-terminator was transferred into T-DNA vector pMOA34 [75] through NotI restriction digestion and ligation. These constructs were then individually transformed into transgenic line containing pBGW-pREV::REV-2YPET;pKAN1::KAN1-2GFP construct. For AT1G14600 reporter, full-length promoter and genomic region was amplified using AT1G14600 FP-CGATAAGCTTGGATCAGGTATTAGAGTTAGTAAAATCAAAG and AT1G14600 RP AGCCGCAGCAGGATCGCTATGGAGTAGAGAAAAGG and then cloned in frame with 2YPET in pBJ36 vector through infusion cloning. Later, the whole expression cassette was transferred into the T-DNA vector pMOA34 [75] through NotI restriction digestion and ligation and then transformed into transgenic line containing pPIN1::PIN1-GFP [86]. DRN translational reporter (pDRN::DRN-GFP) is reported in [87]. This construct was transformed into pREV::REV-2YPET;pPIN1::PIN1-CFP [4] transgenic line. For DRNL reporter, its expression cassette, which consists of its 5,650 bp upstream and 3,822 bp downstream regulatory sequences [88] was hooked to the GR-LHG4 in pENTER L5L2 vector (Invitrogen). Another entry vector pENTER L1R5 containing 6xOP::mCherry-ER, pENTER L5L2 containing DRNL expression cassette with GR-LHG4, and Gateway destination vector pBGW (Invitrogen) were used in Gateway LR reaction (Invitrogen) to produce final construct, pBGW-DRNL expression cassette::GR-LHG4;6OP::mCherry-ER. This constructs was transformed into transgenic line containing pPIN1::PIN1-GFP [86]. ANT reporter, pANT::ANT-VENUS, has previously been described [89]. pHAT3::VENUS-HAT3 [28] and pKAN1::KAN1-2xGFP [4] were combined in T-DNA vector pKGW [74] by Gateway technology (Invitrogen) for generation of a double marker transgenic line pHAT3::VENUS-HAT3;pKAN1::KAN1-2xGFP. A 4687 bp genomic fragment of the DOF5.8 (AT5G66940) gene was amplified using forward primer GGACCCATGAAAGCTTCTTTCTTTGCT and reverse primer CGCTACGTAGTCTCCAGACACGA and then fused as a translational fusion to YPET to create pDOF5.8::DOF5.8-YPET. A double marker line was generated by transforming the pDOF5.8::DOF5.8-YPET into a pPIN1::PIN1-GFP transgenic line. For AS2 reporter, pAS2::2VENUS-AS2 translational fusion was constructed by putting 5037 bp AS2 promoter sequence, using FP acgCGTTTCGTCTAATTCACTTCTCTGTGA and RP ggtaccTTTAATGACTTGAAAATGGAGTTT-TTC, in front of 2VENUS fused to the AS2 coding sequence using which was amplified by FP ggatccATGGCATCTTCTTCAACAAACTCACCATG and RP ggatccccAGACGGATCAACAG-TACG-GCGACCAT. The construct was transformed into the pPIN1::PIN1-CFP transgenic line.
Supporting information
S1 Fig [a]
Flow cytometric analysis of protoplasts derived from triple marker line, containing ::, ::, :: reporters, stained with Propidium Iodide (PI).
S2 Fig [d]
Analysis of gene expression for sorted protoplasts from triple marker line containing ::, ::, :: reporters.
S3 Fig [pdf]
Comparison of cell-type specific genes with relative cell-type specific genes described in [].
S4 Fig [a]
Validation of cell-type specific expression pattern of selected genes.
S5 Fig [a]
Phenotype of transgenic lines used for RNA-Seq.
S6 Fig [a]
Flow cytometric analysis of . protoplasts from various transgenic lines used for RNA-Seq.
S7 Fig [d]
Response of known target genes to REV and KAN1 induction in transgenic lines used for RNA-Seq.
S8 Fig [a]
Co-regulation of common targets of REV and KAN1.
S9 Fig [pdf]
Comparison of gene families regulated in both shoot (this study) and leaf.
S10 Fig [a]
Q-PCR analysis of selected genes in presence and absence of cycloheximide.
S11 Fig [red]
Cell type expression and regulatory data for selected genes responsive to IAA.
S1 Table [xlsx]
Epidermal cell-type enriched genes.
S2 Table [xlsx]
Sets of genes shown in the venn diagram from .
S3 Table [xlsx]
Sub-epidermal cell-type enriched genes.
S4 Table [xlsx]
CPEGs (cell population differentially expressed genes) identified by [], which are relevant to this study and used for comparison in this study.
S5 Table [xlsx]
Comparison of previously published expression data with FACS-based profiling results.
S6 Table [xlsx]
Details of clustering analysis of cell-type profilling experiment, and GO enrichment analysis of the identified clusters.
S7 Table [xlsx]
Details of DEGs identified after induction of .
S8 Table [xlsx]
Details of DEGs identified after induction of .
S9 Table [xlsx]
Details of DEGs identified after induction of .
S10 Table [xlsx]
Comparative analysis of DEGs identified at 6 hrs or 16 hrs induction of and .
S11 Table [xlsx]
Details of clustering analysis performed on REV/KAN1 targets shown in and GO enrichment analysis of the identified clusters.
S12 Table [xlsx]
Comparison of DEGs identified after induction with previously published studies in which REV or KAN1 were induced in seedlings.
S13 Table [xlsx]
Number of genes in each epidermal cell-type and their overlap with REV/KAN1 regulated genes.
S14 Table [xlsx]
Details of cluster 3 genes from , which are expressed more highly outside REV domain, and their GO enrichment analysis.
S15 Table [xlsx]
List of genes upregulated by REV at 16 hrs and down regulated by KAN1 and have enriched expression in both REV and BFP-only cells.
S16 Table [xlsx]
Log2 FC after REV/KAN1 induction, cell-type expression and regulation by auxin for selected development related genes.
S17 Table [xlsx]
Comparative analysis of DEGs identified at 6 hrs induction of and .
S18 Table [xlsx]
Comparative analysis of DEGs identified at 16 hrs induction of and .
S19 Table [xlsx]
Log2 FC after REV/KAN1 induction, cell-type expression and regulation by auxin for selected development related genes which are co-regulated by REV and KAN1.
S20 Table [xlsx]
List of genes up-regulated by auxin (Log2 FC >2 at 30 min) that are functionally characterized in the literature (according to TAIR).
S21 Table [xlsx]
Overlap analysis between different sets of DEGs identified in different RNA-Seq experiments.
S22 Table [xlsx]
Differentially expressed genes after auxin application on meristems, their clustering analysis and GO enrichment analysis of identified clusters.
S23 Table [xlsx]
Log2 FC after REV/KAN1 induction, cell-type expression and regulation by auxin for selected development related genes which were identified as DEGs in RNA-Seq experiment in .
S24 Table [xlsx]
Development related genes up-regulated by auxin at particular time point, their expression changes (Lg2 FC) after REV/KAN1 induction and cell type expression.
S25 Table [xlsx]
Sequence of the primers used in qPCR experiments in this study.
S26 Table [xlsx]
Underlying numerical data for all the graphs presented in this paper.
S1 Text [pdf]
Description of clusters identified in cell-type profiling ().
S1 References [pdf]
Bibliography for the .
Zdroje
1. Reinhardt D, Mandel T, Kuhlemeier C. Auxin regulates the initiation and radial position of plant lateral organs. Plant Cell. 2000;12(4):507–18. doi: 10.1105/tpc.12.4.507 10760240
2. Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, et al. Regulation of phyllotaxis by polar auxin transport. Nature. 2003;426(6964):255–60. doi: 10.1038/nature02081 14628043
3. Bhatia N, Bozorg B, Larsson A, Ohno C, Jonsson H, Heisler MG. Auxin Acts through MONOPTEROS to Regulate Plant Cell Polarity and Pattern Phyllotaxis. Curr Biol. 2016;26(23):3202–8. doi: 10.1016/j.cub.2016.09.044 27818174
4. Caggiano MP, Yu X, Bhatia N, Larsson A, Ram H, Ohno CK, et al. Cell type boundaries organize plant development. eLife. 2017;6. doi: 10.7554/eLife.27421 28895530
5. Pekker I, Alvarez JP, Eshed Y. Auxin response factors mediate Arabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell. 2005;17(11):2899–910. ISI:000232991700007 doi: 10.1105/tpc.105.034876 16199616
6. Guan C, Wu B, Yu T, Wang Q, Krogan NT, Liu X, et al. Spatial Auxin Signaling Controls Leaf Flattening in Arabidopsis. Curr Biol. 2017;27(19):2940–50 e4. doi: 10.1016/j.cub.2017.08.042 28943086
7. de Reuille PB, Bohn-Courseau I, Ljung K, Morin H, Carraro N, Godin C, et al. Computer simulations reveal properties of the cell-cell signaling network at the shoot apex in Arabidopsis. Proc Natl Acad Sci U S A. 2006;103(5):1627–32. doi: 10.1073/pnas.0510130103 16432202
8. Smith RS, Guyomarc'h S, Mandel T, Reinhardt D, Kuhlemeier C, Prusinkiewicz P. A plausible model of phyllotaxis. Proc Natl Acad Sci U S A. 2006;103(5):1301–6. doi: 10.1073/pnas.0510457103 16432192
9. Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, et al. Genome-Wide Identification of KANADI1 Target Genes. Plos One. 2013;8(10). WOS:000325887300080
10. Huang T, Harrar Y, Lin C, Reinhart B, Newell NR, Talavera-Rauh F, et al. Arabidopsis KANADI1 acts as a transcriptional repressor by interacting with a specific cis-element and regulates auxin biosynthesis, transport, and signaling in opposition to HD-ZIPIII factors. Plant Cell. 2014;26(1):246–62. doi: 10.1105/tpc.113.111526 24464295
11. Izhaki A, Bowman JL. KANADI and class III HD-Zip gene families regulate embryo patterning and modulate auxin flow during embryogenesis in Arabidopsis. Plant Cell. 2007;19(2):495–508. doi: 10.1105/tpc.106.047472 17307928
12. Reinhart BJ, Liu T, Newell NR, Magnani E, Huang T, Kerstetter R, et al. Establishing a framework for the Ad/abaxial regulatory network of Arabidopsis: ascertaining targets of class III homeodomain leucine zipper and KANADI regulation. Plant Cell. 2013;25(9):3228–49. doi: 10.1105/tpc.113.111518 24076978
13. Xie Y, Straub D, Eguen T, Brandt R, Stahl M, Martinez-Garcia JF, et al. Meta-Analysis of Arabidopsis KANADI1 Direct Target Genes Identifies a Basic Growth-Promoting Module Acting Upstream of Hormonal Signaling Pathways. Plant Physiol. 2015;169(2):1240–53. doi: 10.1104/pp.15.00764 26246448
14. Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, et al. Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses. Plant J. 2012;72(1):31–42. doi: 10.1111/j.1365-313X.2012.05049.x 22578006
15. Mustroph A, Zanetti ME, Jang CJ, Holtan HE, Repetti PP, Galbraith DW, et al. Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis. Proc Natl Acad Sci U S A. 2009;106(44):18843–8. doi: 10.1073/pnas.0906131106 19843695
16. Deal RB, Henikoff S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 2010;18(6):1030–40. doi: 10.1016/j.devcel.2010.05.013 20627084
17. Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW, et al. A gene expression map of the Arabidopsis root. Science. 2003;302(5652):1956–60. doi: 10.1126/science.1090022 14671301
18. Yadav RK, Tavakkoli M, Xie M, Girke T, Reddy GV. A high-resolution gene expression map of the Arabidopsis shoot meristem stem cell niche. Development. 2014;141(13):2735–44. doi: 10.1242/dev.106104 24961803
19. Sessions A, Weigel D, Yanofsky MF. The Arabidopsis thaliana MERISTEM LAYER 1 promoter specifies epidermal expression in meristems and young primordia. Plant J. 1999;20(2):259–63. doi: 10.1046/j.1365-313x.1999.00594.x 10571886
20. Subach OM, Gundorov IS, Yoshimura M, Subach FV, Zhang J, Gruenwald D, et al. Conversion of red fluorescent protein into a bright blue probe. Chem Biol. 2008;15(10):1116–24. doi: 10.1016/j.chembiol.2008.08.006 18940671
21. Yadav RK, Girke T, Pasala S, Xie M, Reddy GV. Gene expression map of the Arabidopsis shoot apical meristem stem cell niche. Proc Natl Acad Sci U S A. 2009;106(12):4941–6. doi: 10.1073/pnas.0900843106 19258454
22. Samalova M, Brzobohaty B, Moore I. pOp6/LhGR: a stringently regulated and highly responsive dexamethasone-inducible gene expression system for tobacco. Plant J. 2005;41(6):919–35. ISI:000227350700010 doi: 10.1111/j.1365-313X.2005.02341.x 15743454
23. Gardiner J, Sherr I, Scarpella E. Expression of DOF genes identifies early stages of vascular development in Arabidopsis leaves. Int J Dev Biol. 2010;54(8–9):1389–96. doi: 10.1387/ijdb.093006jg 20563990
24. Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM. Glucosinolate metabolites required for an Arabidopsis innate immune response. Science. 2009;323(5910):95–101. doi: 10.1126/science.1164627 19095898
25. Wang B, Chu J, Yu T, Xu Q, Sun X, Yuan J, et al. Tryptophan-independent auxin biosynthesis contributes to early embryogenesis in Arabidopsis. Proc Natl Acad Sci U S A. 2015;112(15):4821–6. doi: 10.1073/pnas.1503998112 25831515
26. Wenkel S, Emery J, Hou BH, Evans MM, Barton MK. A feedback regulatory module formed by LITTLE ZIPPER and HD-ZIPIII genes. Plant Cell. 2007;19(11):3379–90. doi: 10.1105/tpc.107.055772 18055602
27. Wu G, Lin WC, Huang T, Poethig RS, Springer PS, Kerstetter RA. KANADI1 regulates adaxial-abaxial polarity in Arabidopsis by directly repressing the transcription of ASYMMETRIC LEAVES2. Proc Natl Acad Sci USA. 2008;105(42):16392–7. doi: 10.1073/pnas.0803997105 18849474
28. Merelo P, Ram H, Pia Caggiano M, Ohno C, Ott F, Straub D, et al. Regulation of MIR165/166 by class II and class III homeodomain leucine zipper proteins establishes leaf polarity. Proc Natl Acad Sci U S A. 2016. doi: 10.1073/pnas.1516110113 27698117
29. Siegfried KR, Eshed Y, Baum SF, Otsuga D, Drews GN, Bowman JL. Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development. 1999;126(18):4117–28. 10457020
30. Staswick PE, Serban B, Rowe M, Tiryaki I, Maldonado MT, Maldonado MC, et al. Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid. Plant Cell. 2005;17(2):616–27. ISI:000227043800022 doi: 10.1105/tpc.104.026690 15659623
31. Schoof H, Lenhard M, Haecker A, Mayer KF, Jurgens G, Laux T. The stem cell population of Arabidopsis shoot meristems in maintained by a regulatory loop between the CLAVATA and WUSCHEL genes. Cell. 2000;100(6):635–44. doi: 10.1016/s0092-8674(00)80700-x 10761929
32. Strabala TJ, O'Donnell P J, Smit AM, Ampomah-Dwamena C, Martin EJ, Netzler N, et al. Gain-of-function phenotypes of many CLAVATA3/ESR genes, including four new family members, correlate with tandem variations in the conserved CLAVATA3/ESR domain. Plant Physiol. 2006;140(4):1331–44. doi: 10.1104/pp.105.075515 16489133
33. Skylar A, Hong F, Chory J, Weigel D, Wu X. STIMPY mediates cytokinin signaling during shoot meristem establishment in Arabidopsis seedlings. Development. 2010;137(4):541–9. doi: 10.1242/dev.041426 20110319
34. Serikawa KA, Martinez-Laborda A, Zambryski P. Three knotted1-like homeobox genes in Arabidopsis. Plant Mol Biol. 1996;32(4):673–83. doi: 10.1007/bf00020208 8980519
35. Zhou Y, Honda M, Zhu H, Zhang Z, Guo X, Li T, et al. Spatiotemporal sequestration of miR165/166 by Arabidopsis Argonaute10 promotes shoot apical meristem maintenance. Cell Rep. 2015;10(11):1819–27. doi: 10.1016/j.celrep.2015.02.047 25801022
36. Lee DK, Geisler M, Springer PS. LATERAL ORGAN FUSION1 and LATERAL ORGAN FUSION2 function in lateral organ separation and axillary meristem formation in Arabidopsis. Development. 2009;136(14):2423–32. doi: 10.1242/dev.031971 19542355
37. Borghi L, Bureau M, Simon R. Arabidopsis JAGGED LATERAL ORGANS is expressed in boundaries and coordinates KNOX and PIN activity. Plant Cell. 2007;19(6):1795–808. doi: 10.1105/tpc.106.047159 17557810
38. Levin JZ, Meyerowitz EM. UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. Plant Cell. 1995;7(5):529–48. doi: 10.1105/tpc.7.5.529 7780306
39. Alvarez JP, Goldshmidt A, Efroni I, Bowman JL, Eshed Y. The NGATHA distal organ development genes are essential for style specification in Arabidopsis. Plant Cell. 2009;21(5):1373–93. doi: 10.1105/tpc.109.065482 19435933
40. Kuusk S, Sohlberg JJ, Magnus Eklund D, Sundberg E. Functionally redundant SHI family genes regulate Arabidopsis gynoecium development in a dose-dependent manner. Plant J. 2006;47(1):99–111. doi: 10.1111/j.1365-313X.2006.02774.x 16740146
41. Crawford BC, Ditta G, Yanofsky MF. The NTT gene is required for transmitting-tract development in carpels of Arabidopsis thaliana. Curr Biol. 2007;17(13):1101–8. doi: 10.1016/j.cub.2007.05.079 17600712
42. Barbez E, Kubes M, Rolcik J, Beziat C, Pencik A, Wang B, et al. A novel putative auxin carrier family regulates intracellular auxin homeostasis in plants. Nature. 2012;485(7396):119–22. doi: 10.1038/nature11001 22504182
43. Galweiler L, Guan C, Muller A, Wisman E, Mendgen K, Yephremov A, et al. Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science. 1998;282(5397):2226–30. doi: 10.1126/science.282.5397.2226 9856939
44. Friml J, Benkova E, Blilou I, Wisniewska J, Hamann T, Ljung K, et al. AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell. 2002;108(5):661–73. doi: 10.1016/s0092-8674(02)00656-6 11893337
45. Peret B, Swarup K, Ferguson A, Seth M, Yang Y, Dhondt S, et al. AUX/LAX genes encode a family of auxin influx transporters that perform distinct functions during Arabidopsis development. Plant Cell. 2012;24(7):2874–85. doi: 10.1105/tpc.112.097766 22773749
46. Mancuso S, Marras AM, Mugnai S, Schlicht M, Zarsky V, Li G, et al. Phospholipase dzeta2 drives vesicular secretion of auxin for its polar cell-cell transport in the transition zone of the root apex. Plant Signal Behav. 2007;2(4):240–4. doi: 10.4161/psb.2.4.4566 19516994
47. Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldmann KA, Meyerowitz EM. The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors. Nature. 1990;346(6279):35–9. doi: 10.1038/346035a0 1973265
48. Payne CT, Zhang F, Lloyd AM. GL3 encodes a bHLH protein that regulates trichome development in arabidopsis through interaction with GL1 and TTG1. Genetics. 2000;156(3):1349–62. 11063707
49. Lee BH, Kwon SH, Lee SJ, Park SK, Song JT, Lee S, et al. The Arabidopsis thaliana NGATHA transcription factors negatively regulate cell proliferation of lateral organs. Plant Mol Biol. 2015;89(4–5):529–38. doi: 10.1007/s11103-015-0386-y 26433582
50. Lampugnani ER, Kilinc A, Smyth DR. PETAL LOSS is a boundary gene that inhibits growth between developing sepals in Arabidopsis thaliana. Plant J. 2012;71(5):724–35. doi: 10.1111/j.1365-313X.2012.05023.x 22507233
51. Kuusk S, Sohlberg JJ, Long JA, Fridborg I, Sundberg E. STY1 and STY2 promote the formation of apical tissues during Arabidopsis gynoecium development. Development. 2002;129(20):4707–17. 12361963
52. Kumar R, Kushalappa K, Godt D, Pidkowich MS, Pastorelli S, Hepworth SR, et al. The Arabidopsis BEL1-LIKE HOMEODOMAIN proteins SAW1 and SAW2 act redundantly to regulate KNOX expression spatially in leaf margins. Plant Cell. 2007;19(9):2719–35. doi: 10.1105/tpc.106.048769 17873098
53. Shuai B, Reynaga-Pena CG, Springer PS. The lateral organ boundaries gene defines a novel, plant-specific gene family. Plant Physiol. 2002;129(2):747–61. doi: 10.1104/pp.010926 12068116
54. Cheng Y, Dai X, Zhao Y. Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes Dev. 2006;20(13):1790–9. doi: 10.1101/gad.1415106 16818609
55. Mai YX, Wang L, Yang HQ. A gain-of-function mutation in IAA7/AXR2 confers late flowering under short-day light in Arabidopsis. J Integr Plant Biol. 2011;53(6):480–92. doi: 10.1111/j.1744-7909.2011.01050.x 21564544
56. Nagpal P, Ellis CM, Weber H, Ploense SE, Barkawi LS, Guilfoyle TJ, et al. Auxin response factors ARF6 and ARF8 promote jasmonic acid production and flower maturation. Development. 2005;132(18):4107–18. doi: 10.1242/dev.01955 16107481
57. Nakata M, Matsumoto N, Tsugeki R, Rikirsch E, Laux T, Okada K. Roles of the middle domain-specific WUSCHEL-RELATED HOMEOBOX genes in early development of leaves in Arabidopsis. Plant Cell. 2012;24(2):519–35. doi: 10.1105/tpc.111.092858 22374393
58. Goldshmidt A, Alvarez JP, Bowman JL, Eshed Y. Signals derived from YABBY gene activities in organ primordia regulate growth and partitioning of Arabidopsis shoot apical meristems. Plant Cell. 2008;20(5):1217–30. doi: 10.1105/tpc.107.057877 18469164
59. Lee YK, Kim GT, Kim IJ, Park J, Kwak SS, Choi G, et al. LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate longitudinal cell elongation in Arabidopsis. Development. 2006;133(21):4305–14. doi: 10.1242/dev.02604 17038516
60. Zurcher E, Liu J, di Donato M, Geisler M, Muller B. Plant development regulated by cytokinin sinks. Science. 2016;353(6303):1027–30. doi: 10.1126/science.aaf7254 27701112
61. Hardtke CS, Berleth T. The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development. EMBO J. 1998;17(5):1405–11. doi: 10.1093/emboj/17.5.1405 9482737
62. Przemeck GK, Mattsson J, Hardtke CS, Sung ZR, Berleth T. Studies on the role of the Arabidopsis gene MONOPTEROS in vascular development and plant cell axialization. Planta. 1996;200(2):229–37. doi: 10.1007/bf00208313 8904808
63. Redman JC, Haas BJ, Tanimoto G, Town CD. Development and evaluation of an Arabidopsis whole genome Affymetrix probe array. Plant J. 2004;38(3):545–61. ISI:000220853200014 doi: 10.1111/j.1365-313X.2004.02061.x 15086809
64. Nemhauser JL, Hong F, Chory J. Different plant hormones regulate similar processes through largely nonoverlapping transcriptional responses. Cell. 2006;126(3):467–75. doi: 10.1016/j.cell.2006.05.050 16901781
65. Goda H, Sasaki E, Akiyama K, Maruyama-Nakashita A, Nakabayashi K, Li W, et al. The AtGenExpress hormone and chemical treatment data set: experimental design, data evaluation, model data analysis and data access. Plant J. 2008;55(3):526–42. doi: 10.1111/j.0960-7412.2008.03510.x 18419781
66. Yang XQ, Lee S, So JH, Dharmasiri S, Dharmasiri N, Ge L, et al. The IAA1 protein is encoded by AXR5 and is a substrate of SCFTIR1. Plant J. 2004;40(5):772–82. ISI:000225188000012 doi: 10.1111/j.1365-313X.2004.02254.x 15546359
67. Sun J, Qi L, Li Y, Zhai Q, Li C. PIF4 and PIF5 transcription factors link blue light and auxin to regulate the phototropic response in Arabidopsis. Plant Cell. 2013;25(6):2102–14. doi: 10.1105/tpc.113.112417 23757399
68. Zhang Z, Tucker E, Hermann M, Laux T. A Molecular Framework for the Embryonic Initiation of Shoot Meristem Stem Cells. Dev Cell. 2017;40(3):264–77 e4. doi: 10.1016/j.devcel.2017.01.002 28171749
69. Del Carmen Martinez-Ballesta M, Moreno DA, Carvajal M. The physiological importance of glucosinolates on plant response to abiotic stress in Brassica. Int J Mol Sci. 2013;14(6):11607–25. doi: 10.3390/ijms140611607 23722664
70. Ma Y, Miotk A, Sutikovic Z, Ermakova O, Wenzl C, Medzihradszky A, et al. WUSCHEL acts as an auxin response rheostat to maintain apical stem cells in Arabidopsis. Nature communications. 2019;10(1):5093. doi: 10.1038/s41467-019-13074-9 31704928
71. Bennett T, Sieberer T, Willett B, Booker J, Luschnig C, Leyser O. The Arabidopsis MAX pathway controls shoot branching by regulating auxin transport. Curr Biol. 2006;16(6):553–63. doi: 10.1016/j.cub.2006.01.058 16546078
72. Talbert PB, Adler HT, Parks DW, Comai L. The REVOLUTA gene is necessary for apical meristem development and for limiting cell divisions in the leaves and stems of Arabidopsis thaliana. Development. 1995;121(9):2723–35. 7555701
73. Emery JF, Floyd SK, Alvarez J, Eshed Y, Hawker NP, Izhaki A, et al. Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr Biol. 2003;13(20):1768–74. doi: 10.1016/j.cub.2003.09.035 14561401
74. Karimi M, Inze D, Depicker A. GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 2002;7(5):193–5. doi: 10.1016/s1360-1385(02)02251-3 11992820
75. Barrell PJ, Conner AJ. Minimal T-DNA vectors suitable for agricultural deployment of transgenic plants. Biotechniques. 2006;41(6):708–10. doi: 10.2144/000112306 17191614
76. S. A. Babraham Bioinformatics—FastQC A Quality Control Tool for High Throughput Sequence Data 2013. Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/.
77. Martin M. Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads. EMBnetjournal 2011;17(1):10–2.
78. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25(9):1105–11. WOS:000265523300002 doi: 10.1093/bioinformatics/btp120 19289445
79. Anders S, Pyl PT, Huber W. HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31(2):166–9. doi: 10.1093/bioinformatics/btu638 25260700
80. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. doi: 10.1186/s13059-014-0550-8 25516281
81. Alexa A, Rahnenfuhrer, J. topGO: Enrichment Analysis for Gene Ontology 2010. Available from: https://rdrr.io/bioc/topGO/.
82. Goder A, Filkov V. Consensus Clustering Algorithms: Comparison and Refinement. Siam Proc S. 2008:109–17. WOS:000289650200011
83. Page L, Brin, S., Motwani, R., Winograd, T. The Pagerank Citation Ranking: Bringing Order to the web. technical report. Stanford InfoLab Publication Server: 1999 Contract No.: 422.
84. Rosvall M. AD, Bergstrom C. T. The map equation. The European Physical Journal Special Topics. 2009;178:13–23.
85. Csardi G, Nepusz T. The igraph software package for complex network research. InterJournal, Complex Systems. 2006.
86. Heisler MG, Ohno C, Das P, Sieber P, Reddy GV, Long JA, et al. Patterns of auxin transport and gene expression during primordium development revealed by live imaging of the Arabidopsis inflorescence meristem. Current Biology. 2005;15(21):1899–911. WOS:000233422900019 doi: 10.1016/j.cub.2005.09.052 16271866
87. Cole M, Chandler J, Weijers D, Jacobs B, Comelli P, Werr W. DORNROSCHEN is a direct target of the auxin response factor MONOPTEROS in the Arabidopsis embryo. Development. 2009;136(10):1643–51. doi: 10.1242/dev.032177 19369397
88. Chandler JW, Jacobs B, Cole M, Comelli P, Werr W. DORNROSCHEN-LIKE expression marks Arabidopsis floral organ founder cells and precedes auxin response maxima. Plant Mol Biol. 2011;76(1–2):171–85. doi: 10.1007/s11103-011-9779-8 21547450
89. Yamaguchi N, Jeong CW, Nole-Wilson S, Krizek BA, Wagner D. AINTEGUMENTA and AINTEGUMENTA-LIKE6/PLETHORA3 Induce LEAFY Expression in Response to Auxin to Promote the Onset of Flower Formation in Arabidopsis. Plant Physiol. 2016;170(1):283–93. doi: 10.1104/pp.15.00969 26537561
Článek vyšel v časopise
PLOS Genetics
2020 Číslo 4
- Ukažte mi, jak kašlete, a já vám řeknu, co vám je
- Prof. Jan Škrha: Metformin je bezpečný, ale je třeba jej bezpečně užívat a léčbu kontrolovat
- FDA varuje před selfmonitoringem cukru pomocí chytrých hodinek. Jak je to v Česku?
- Ibuprofen jako alternativa antibiotik při léčbě infekcí močových cest
- Top zaměstnavatelé ve zdravotnictví si hýčkají už studenty
Nejčtenější v tomto čísle
- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Molecular genetics of maternally-controlled cell divisions
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum
Zvyšte si kvalifikaci online z pohodlí domova
Současné možnosti léčby obezity
nový kurzVšechny kurzy