Inositol 1,4,5-trisphosphate receptors are essential for fetal-maternal connection and embryo viability
Authors:
Feili Yang aff001; Lei Huang aff002; Alexandria Tso aff003; Hong Wang aff001; Li Cui aff003; Lizhu Lin aff003; Xiaohong Wang aff004; Mingming Ren aff002; Xi Fang aff003; Jie Liu aff005; Zhen Han aff002; Ju Chen aff003; Kunfu Ouyang aff001
Authors place of work:
School of Chemical Biology and Biotechnology, State Key Laboratory of Chemical Oncogenomics, Peking University Shenzhen Graduate School, Shenzhen, China
aff001; Department of Cardiovascular Surgery, Peking University Shenzhen Hospital, Shenzhen, China
aff002; University of California San Diego, School of Medicine, Department of Medicine, La Jolla, CA, United States of America
aff003; Department of Pharmacology, Tianjin Key Laboratory of Inflammation Biology, School of Basic Medical Sciences, Tianjin Medical University, Tianjin, China
aff004; Department of Pathophysiology, School of Medicine, Shenzhen University, Shenzhen, China
aff005
Published in the journal:
Inositol 1,4,5-trisphosphate receptors are essential for fetal-maternal connection and embryo viability. PLoS Genet 16(4): e32767. doi:10.1371/journal.pgen.1008739
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1008739
Summary
Inositol 1,4,5‐trisphosphate receptors (IP3Rs) are a family of intracellular Ca2+ release channels located on the ER membrane, which in mammals consist of 3 different subtypes (IP3R1, IP3R2, and IP3R3) encoded by 3 genes, Itpr1, Itpr2, and Itpr3, respectively. Studies utilizing genetic knockout mouse models have demonstrated that IP3Rs are essential for embryonic survival in a redundant manner. Deletion of both IP3R1 and IP3R2 has been shown to cause cardiovascular defects and embryonic lethality. However, it remains unknown which cell types account for the cardiovascular defects in IP3R1 and IP3R2 double knockout (DKO) mice. In this study, we generated conditional IP3R1 and IP3R2 knockout mouse models with both genes deleted in specific cardiovascular cell lineages. Our results revealed that deletion of IP3R1 and IP3R2 in cardiomyocytes by TnT-Cre, in endothelial / hematopoietic cells by Tie2-Cre and Flk1-Cre, or in early precursors of the cardiovascular lineages by Mesp1-Cre, resulted in no phenotypes. This demonstrated that deletion of both IP3R genes in cardiovascular cell lineages cannot account for the cardiovascular defects and embryonic lethality observed in DKO mice. We then revisited and performed more detailed phenotypic analysis in DKO embryos, and found that DKO embryos developed cardiovascular defects including reduced size of aortas, enlarged cardiac chambers, as well as growth retardation at embryonic day (E) 9.5, but in varied degrees of severity. Interestingly, we also observed allantoic-placental defects including reduced sizes of umbilical vessels and reduced depth of placental labyrinth in DKO embryos, which could occur independently from other phenotypes in DKO embryos even without obvious growth retardation. Furthermore, deletion of both IP3R1 and IP3R2 by the epiblast-specific Meox2-Cre, which targets all the fetal tissues and extraembryonic mesoderm but not extraembryonic trophoblast cells, also resulted in embryonic lethality and similar allantoic-placental defects. Taken together, our results demonstrated that IP3R1 and IP3R2 play an essential and redundant role in maintaining the integrity of fetal-maternal connection and embryonic viability.
Keywords:
Embryos – Mouse models – Mesoderm – Growth restriction – Placenta – Trophoblasts – Somites
Introduction
Inositol 1,4,5-trisphosphate (IP3) receptors (IP3Rs) are a family of intracellular Ca2+ release channels located on the membrane of endoplasmic reticulum (ER), which mediate Ca2+ mobilization from the ER to the cytoplasm when the receptors bind to the secondary messenger IP3 [1]. Three different subtypes of IP3Rs have been identified in mammals (IP3R1, IP3R2, and IP3R3) [2]. Using gene-knockout mouse models, IP3Rs have been shown to play an essential role in regulating diverse physiological processes, including brain function [3], taste perception [4], embryonic survival [5–7], extra-embryonic vascular development [7], exocrine secretion [8], T cell development [9], B cell function [10], gastrointestinal motility [11], vascular contractility and hypertension [12,13]. Interestingly, many of these studies demonstrated that IP3Rs are ubiquitously expressed and may function in a mechanism of redundancy between different subtypes [5–10,12,13]. In particular, IP3R1 and IP3R2 have been implied to play a role in regulating embryonic cardiac development. Deletion of both IP3R1 and IP3R2 caused developmental defects of ventricular myocardium and atrioventricular canal of the hearts, and embryonic lethality [6]. Since IP3R expression has been shown to occur before the appearance of ryanodine receptors in the early embryo [14], IP3R has been long proposed to drive the first cycling of Ca2+ within the heart and thus regulate embryonic cardiac development [15]. However, whether IP3R-mediated Ca2+ signaling was required for normal cardiac development and whether loss of IP3Rs in cardiovascular cell lineages could account for embryonic lethality of the IP3R1 and IP3R2 double knockout (DKO) mice remain unknown.
To address this question, we generated both conventional and tissue-specific IP3R1 and IP3R2 double knockout mouse models. Our results revealed that deletion of IP3R1 and IP3R2 in cardiomyocytes by TnT-Cre, in endothelial / hematopoietic cells by Tie2-Cre and Flk1-Cre, or in early precursors of the cardiovascular lineages by Mesp1-Cre, resulted in no embryonic lethal phenotypes, demonstrating that IP3R1 and IP3R2 in cardiovascular cell lineages are dispensable for embryonic survival. Subsequently, we observed the allantoic-placental defects that could occur independently from other phenotypes in DKO embryos. The placenta is a vital organ, which sits at the interface between the maternal and fetal circulation and facilitates the transport of nutrients and oxygen into the fetus [16]. The placenta is essential for survival and growth of the fetus during gestation, and placental dysfunction has been shown to result in various pregnancy diseases, fetal growth restriction, other pregnancy-associated disorders, and even embryonic death [17,18]. We found that the DKO embryos displayed reduced sizes of umbilical vessels and reduced depth of placental labyrinth. Furthermore, we generated a conditional IP3R1 and IP3R2 knockout mouse line utilizing the epiblast-specific Meox2-Cre (cKOMeox2), which targets all the fetal tissues and extraembryonic mesoderm but not extraembryonic trophoblast cells. The cKOMeox2 embryos displayed embryonic lethality and allantoic-placental defects, similar as DKO embryos, suggesting that epiblast cell lineages could, at least partially, account for the phenotypes observed in global IP3R1 and IP3R2 double knockout embryos. Taken together, our results demonstrated that IP3R1 and IP3R2 play an essential role in maintaining the integrity of fetal-maternal connection and embryonic viability.
Materials and methods
Mice
The generation of Itpr1 mutant (Itpr1-/-), Itpr1 floxed (Itpr1f/f), and Itpr2 mutant (Itpr2-/-) mice has been previously described, respectively [9,19,20]. The Itpr1+/-Itpr2-/- mice were generated and further intercrossed with each other to generate the global IP3R1 and IP3R2 double knockout (Itpr1-/-Itpr2-/-, DKO) and control (Itpr1+/+Itpr2-/-) mice. On the other hand, the Itpr1f/fItpr2-/- mice were crossed with the Tg(Tnnt2-cre)5Blh/JiaoJ (TnT-Cre; Jackson Laboratory) mice that express the Cre recombinase under the control of the rat cardiac troponin T2 [21], the B6.Cg-Tg(Tek-cre)1Ywa/J (Tie2-Cre; Jackson Laboratory) mice that have the mouse endothelial-specific receptor tyrosine kinase promoter directing expression of Cre recombinase [22], the Kdrtm1(cre)Sato/J (Flk1-Cre; Jackson Laboratory) mice that express the Cre recombinase under the control of the kinase insert domain protein receptor gene [23], the ICR.Cg-Mesp1tm2(cre)Ysa/YsaRbrc (Mesp1-Cre; International Mouse Strain Resource) mice that express the Cre recombinase under the control of endogenous promoter-enhancer [24], and the B6.129S4-Meox2tm1(cre)Sor/J (Meox2-Cre; Jackson Laboratory) mice that express the Cre recombinase under the control of the endogenous Meox2 promoter [25], to generate the cell / tissue-specific IP3R1 and IP3R2 double knockout mice, respectively. Briefly, male Cre+Itpr1f/+Itpr2-/- mice were generated and then crossed with female Cre-Itpr1f/fItpr2-/- mice for examination of the vaginal plug. Genotypic analysis was first performed at postnatal day 1 to see whether the offspring from each cross were born at Mendelian ratios. If embryonic lethality was suspected, embryos were then dissected at various embryonic stages. Otherwise, embryos were only collected at embryonic day (E) 10.5 for morphological analysis. Mesp1-Cre and Meox2-Cre mice were also crossed with the B6.129S4-Gt(ROSA)26Sortm1Sor/J (Rosa-LacZ; Jackson Laboratory) mice to generate Mesp1-Cre/Rosa-LacZ and Meox2-Cre/Rosa-LacZ mice for cell lineage tracing analysis, respectively.
DNA analysis
Genomic DNA was extracted from mouse tails or embryonic yolk sacs as previously described [26], and polymerase chain reaction (PCR) was utilized to genotype the mice using the following gene-specific primers (from 5’ to 3’): Itpr1 wildtype and floxed allele (forward, AGACCTCTGCCTTAGGA GGTATTT; reverse, ACTGGGCAGGCATATATAGTTAGC), Itpr1 mutant allele (forward, AGACCTCTG CCTTAGGAGGTATTT; reverse, TTTAAGAAAGCAAGGAGAAGGAGA), Itpr2 wildtype allele (forward, GCTGTGCCCAAAATCCTAGCACTG; reverse, CATGCAGAGGTCGTGTCAGTCATT), mutant allele (forward, AATGGGCTGACCGCTTCCTCGT; reverse, AGTGATACAGGGCAAGTTCATAC), TnT-Cre / Flk1-Cre (forward, GAGCATACCTGGAAAATGCTTC; reverse, CCGGCAAAACAGGTAGTTATTC), Tie2-Cre (forward, CCCTGTGCTCAGACAGAAATGAGA; reverse, CGCATAACCAGTGA AACAGCATTGC), Mesp1-Cre (forward, CTCTGAGCATGGTTCTTTCAAC; reverse, TCCCTGAA CATGTCCATCAGGTTC), Meox2-Cre (forward, ACCTCTCCCACACTTGACATCT; reverse, GAAGCATTTTCCAGGTATGCTC), Rosa-Laz (forward 1, AAAGTCGCTCTGAGTTGTTAT; forward 2, GCGAAGAGTTTGTCCTCAACC; reverse, GGAGCGGGAGAAATGGATATG).
Quantitative real time PCR analysis
The hearts and blood cells were collected from mouse embryos at E10.5, and total RNA was extracted using TRIzol reagent (Invitrogen). cDNA was synthesized using the TransScript One-Step cDNA Synthesis SuperMix Kit (Transgen Biotech). Quantitative real time PCR was then performed using TransStart Tip Green qPCR SuperMix (Transgen Biotech) according to the manufacturer’s instruction. The sequences for primers of Itpr1 and Gapdh were used as previously described [27]. Relative transcript abundance was normalized to Gapdh. Each sample was run at least in duplicate.
Morphological and histological analysis
Mice were mated under the standard 12-hour light / dark cycle, and noon on the day of the appearance of the vaginal plug was defined as the embryonic day 0.5 (E0.5). Embryos and placentas were dissected and collected under a Leica MZ6 dissecting light microscope and photographed as previously described [28]. The tissues were then fixed in 4% paraformaldehyde (PFA) diluted in phosphate buffered saline (PBS). For paraffin sections, the tissues were dehydrated through ethanol gradients and xylene, and embedded in paraffin. Serial sections (7 μm thick) were obtained and stained with hematoxylin and eosin (H&E) as previously described [29]. For frozen sections, tissues were incubated in a graded series of sucrose concentrations from 15% to 25%, and then embedded in optimal cutting temperature (OCT) compound (Sakura Finetek USA Inc., Torrance, CA, USA).
Whole-mount RNA in situ hybridization
In situ hybridization was performed using digoxigenin-labeled antisense riboprobes against Itpr1 (nucleotides 5051–6199, Genbank accession no. NM_010585.2), Itpr2 (nucleotides 4629–5644, Genbank accession no. NM_010586.1), and Itpr3 (nucleotides 7974–8733, Genbank, NM_080553.2). Briefly, embryos were collected and fixed in 4% PFA overnight, and then washed twice with PBS containing 0.1% Tween-20 (PBT). The embryos were dehydrated through a series of PBT-methanol washes and rehydrated through a reciprocal series of PBT-methanol washes. The embryos were then treated with 6% hydrogen peroxide diluted in PBT for 1 hour, followed by the digestion with 10μg/ml proteinase at room temperature for varied times depending on the stage of embryos. The digestion was stopped by 2 mg/ml glycine diluted in PBT. The samples were then post-fixed in 4% PFA, 0.2% glutaraldehyde and 0.1% Tween-20 for 20 minutes at room temperature, and prehybridized 2 hours in hybridization solution (50% formamide, 5X SSC, 1% SDS, 100 μg/ml yeast tRNA, 50 μg/ml heparin) at 65°C. After that, the embryos were incubated with fresh hybridization solution containing the digoxigenin-conjugated riboprobe at 65°C with rocking overnight. After hybridization, the embryos were washed twice with solution I (50% formamide, 5X SSC, 1% SDS) at 65°C (for 30 minutes each time), twice with solution II (50% formamide, 2X SSC) at 65°C (for 30 minutes each time), and then with TBST containing 140 mM NaCl, 2.5 mM KCl, 25 mM Tris, and 0.1% Tween-20. The embryos were then incubated with a blocking solution containing 1% blocking reagent at room temperature, followed by another incubation with a fresh blocking solution containing the anti-digoxigenin AP-conjugated antibody at 4°C. Finally, signals were detected using the NBT/BCIP solution and photographed under a stereomicroscope.
RNA in situ hybridization in cryosections
RNA in situ hybridization in cryosections was performed as previously described [30]. The probes against Hand1, Csh1 and Dlx3 are a kind gift from J.C. Cross. Sections (10 μm) were briefly rehydrated in PBS, post-fixed in 4% PFA, and treated with proteinase K (15 μg/ml) for various times depending on the ages of the embryos. The samples were then acetylated for 10 minutes in 0.25% (v/v) acetic anhydride, and hybridized with digoxigenin-conjugated riboprobes overnight at 65°C in sealed humidified boxes. After hybridization, the sections were treated with RNase, incubated with the blocking solution, and then treated with anti-digoxigenin AP-conjugated antibody. Signals were detected using the NBT/BCIP solution and photographed.
Whole-mount PECAM staining
Whole-mount PECAM staining was performed as previously described [28]. Briefly, the embryos dissected in ice cold PBS were fixed in 4% PFA overnight at 4°C. After fixation, the embryos were dehydrated in a graded methanol series (methanol concentrations of 25, 50, 75, and 100%, for 15 minutes each) at room temperature. After bleaching with 5% hydrogen peroxide in methanol for 4–5 hours, the embryos were then rehydrated using 75, 50, and 25% methanol and washed with PBS. After that, the embryos were incubated with the blocking solution for several hours at room temperature, and subsequently with the primary CD31 antibody (BD Pharmingen, catalog no. 550274) at 4°C overnight, followed by the incubation with the HRP-conjugated goat anti-rat IgG (Zsbio, catalog no.ZB2307) at 4°C overnight. The signals were developed using 3’,3’-diaminobenzidine, and photographed under a stereomicroscope.
X-gal staining
For whole-mount X-gal staining, mouse embryos and placentas were freshly collected and fixed in 4% PFA at 4°C for 1 hour, and then washed three times, each time with cold PBS for 10 minutes. The samples were subsequently stained in the X-gal solution containing 5 mM ferrocyanide, 5 mM ferricyanide, 2 mM MgCl2, 1 mg/ml X-gal, 0.01% sodium deoxycholate, 0.02% NP-40, for several hours at 37°C.
For cryosections, the tissues were freshly collected, fixed in 4% PFA, and embedded in OCT compound. Cryosections (10 μm) were prepared and stained with the X-gal solution. Nuclear Fast Red was used to counterstain the sections.
Transmission electron microscopy
Placentas were fixed with 2% PFA and 2% glutaraldehyde in 0.1 M phosphate buffer (pH 7.3). Specimens were post-fixed with 2% osmium tetroxide for 2 hours, stained with 3% uranyl acetate for 2 hours, and embedded in epoxy resin. Thin sections were cut, stained with uranyl acetate and lead citrate, and examined with transmission electron microscope.
Statistics
Scatter diagrams were drawn using Graphpad Prism 5. Statistical analysis was performed using a two-tailed, unpaired Student’s t test as previously described [31]. All data represent mean ± SEM (error bars). P < 0.05 was considered statistically significant.
Ethics statement
All mice were housed under a 12-hour day/night cycle at a temperature of 25°C. All animal care and experiments were conducted in accordance with the guidelines established by the Animal Care and Use Committee (IACUC) at Peking University Shenzhen Graduate School (Shenzhen, China), and approved by the IACUC (Approval #: AP0017). Periodic review of procedures was performed, and amendments were made as needed.
Results
Deletion of both IP3R1 and IP3R2 in mice caused growth retardation and embryonic lethality
To understand the role of IP3Rs in embryonic development, we first assessed expression of IP3R subtypes during early stages of embryonic development using RNA in situ hybridization (S1 Fig). IP3R subtypes were expressed in an overlapping fashion in mouse embryos including endocardium and atrioventricular cushions. In addition, distinct IP3R expression patterns were also observed in other embryonic domains, including pharyngeal arch arteries, sinus venosus, aortic endothelium, and forelimb (S1 Fig).
We then generated global IP3R1 and IP3R2 double knockout (Itpr1-/-Itpr2-/-, DKO) mouse model by intercrossing phenotypically normal Itpr1+/-Itpr2-/- mice (Fig 1A). Genotypic analysis revealed that no live DKO pups or embryos could be found after the embryonic day 14.5 (E14.5; Table 1). At E11.5, 4 of 44 embryos were identified as DKO pups, but all 4 of these DKO embryos were dead, developing no heart beat and undergoing reabsorption. On the other hand, DKO embryos were observed at the expected Mendelian ratio at E10.5, indicating that DKO embryos die sometime between E10.5 and E11.5, which is consistent with a previous study [6]. However, all DKO embryos at E10.5 developed apparent growth retardation and enlarged ventricles (Fig 1B), and most (21 off 23) DKO embryos developed chest edema, indicating cardiovascular dysfunction (Fig 1B). At E9.5, DKO embryos also exhibited growth retardation but with varied degrees when compared with their somite pair-matched control embryos (Fig 1B). The number of somite pairs in DKO embryos was significantly lower when their littermate control or Itpr1+/-Itpr2-/- embryos had somite pairs between 22–24 or above 25. On the other hand, numbers of somite pairs in DKO embryos were comparable when their littermate control embryos had less than 22 somite pairs (Fig 1C), thus indicating an age-dependent growth retardation in DKO embryos. In addition, histological assessment in control and DKO embryos at the stage of 23–24 somite pairs also revealed that DKO embryos with obvious growth retardation (3 off 11 DKO embryos) exhibited both enlarged cardiac chambers and reduced size of aortas when compared with control embryos, whereas DKO embryos with no obvious growth retardation at the same stage only exhibited reduced size of aortas (Fig 1D).
Deletion of IP3R genes in cardiovascular cell lineages did not cause embryonic lethality
We then investigated whether cells of cardiovascular origin were responsible for cardiovascular defects and embryonic lethality in DKO embryos. We first generated a series of conditional IP3R1 knockout mouse models in IP3R2 null background using cardiac muscle-specific expressing TnT-Cre [21], and endothelial / hematopoietic cell-specific expressing Tie2-Cre and Flk1-Cre [22,23]. It has been shown in our laboratory that TnT-Cre and Tie2-Cre are very efficient at deleting multiple floxed genes in mouse embryos [9,28,32,33]. We also performed quantitative real time PCR to examine expression of the Itpr1 gene, and found that Itpr1 mRNA levels were dramatically reduced in hearts of TnT-Cre+Itpr1f/fItpr2-/- embryos, and in blood cells of Tie2-Cre+Itpr1f/fItpr2-/- and Flk1-Cre+Itpr1f/fItpr2-/- embryos, when compared with those control embryos (S2A–S2C Fig). To our surprise, ablation of IP3R1 by TnT-Cre, Tie2-Cre or Flk1-Cre in IP3R2 null background did not result in any embryonic lethality (S1 Table). The embryos with conditional deletion of IP3R1 by TnT-Cre, Tie2-Cre or Flk1-Cre in IP3R2 null background were also phenotypically indistinguishable from control embryos at E10.5, exhibiting no growth retardation (Fig 2A–2C). Mesp1, a transcription factor of the b-HLH family, is the earliest marker of the cardiovascular lineages [34,35]. Cell lineage tracing analysis of Mesp1-Cre/Rosa-LacZ embryos and placentas at E9.5 have consistently shown that Mesp1-Cre can target the endothelium, endocardium, and myocardium in the embryonic heart, as well as the fetal endothelium from the allantoic capillaries in the placenta (S3A Fig). We also found that Itpr1 mRNA levels in hearts of Mesp1-Cre+Itpr1f/fItpr2-/- mice were significantly decreased when compared with those of Mesp1-Cre -Itpr1f/fItpr2-/- mice (S2D Fig). However, Mesp1-Cre mediated ablation of IP3R1 in IP3R2 null mice also did not cause any abnormality in embryonic development or embryonic lethality (Fig 2D; S3B Fig; S1 Table). Taken together, these results demonstrated that deletion of both IP3R1 and IP3R2 genes in cardiac cells, endothelial cells or even early precursors of the cardiovascular system is not responsible for early embryonic developmental defects observed in DKO mice. Therefore, our results indicate the alternative possibility that allantoic and/or placental defects may account for the embryonic lethality of DKO embryos.
DKO embryos developed allantoic-placental defects
The placenta and allantois play an essential role in sustaining fetal growth throughout the gestational period. In mice, placental development starts at embryonic day (E) 3.5 when the outer trophectoderm layer and the inner cell mass are formed [18]. At the time of implantation (E4.5), different trophoblast cell types begin to form. The allantois arises from the mesoderm at the posterior end of the embryo and joins to the chorion at E8.5 [36]. Once the distal end of the allantois is joined with the chorion, the chorion begins to fold, making a space where fetal blood vessels grow in from the allantois to generate the fetal components of the placental vasculature. The trophoblast, together with fetal blood vessels, undergoes extensive villous branching to generate the labyrinth that is supported by the spongiotrophoblast [37,38]. The maternal blood supply passes through the spongiotrophoblast via the maternal arterial sinuses, and the umbilical artery and vein connect the fetal vasculature of the placenta to the developing fetus [38,39]. Defects in the placenta development and function are known to lead to fetal growth retardation and, in more severe cases, secondary cardiac phenotypes and embryonic lethality [38,40–42].
Indeed, we found that DKO embryos at E9.5 exhibited allantoic-placental abnormalities. To minimize the difference in embryonic body size, DKO and somite pair-matched control embryos with comparable growth were collected at E9.5 and examined. First of all, we found that the size/diameter of the umbilical vein that is located in the caudal trunk was significantly reduced in DKO embryos at E9.5, when compared with the somite pair-matched control embryos (Fig 3A; S4A and S4B Fig). Furthermore, the density of umbilical vein plexus was also dramatically decreased in DKO embryos, evidenced by the reduction of branches from the umbilical vein in DKO embryos when compared with control embryos (Fig 3A; S4C and S4D Fig). In addition, the size of the umbilical cord / allantois in DKO embryos was also apparently reduced at this stage (Fig 3B), which was further confirmed by histological assessment, evidenced by the reduction of the averaged perimeters of umbilical vessels in DKO embryos when compared with somite pair-matched control embryos (Fig 3C and 3D).
We also investigated whether DKO embryos developed placental defects. For this purpose, we then assessed expression of IP3R subtypes in mouse placenta and allantois at E8.5–9.5. IP3R1 and IP3R3 were both expressed in cells of the maternal decidua, chorion mesoderm, spongiotrophoblast, labyrinth layer of the placenta, and the allantois (S5A and S5C Fig). On the other hand, assessment of IP3R2 expression in placenta revealed uniform expression throughout the placenta and allantois at both E8.5 to E9.5 (S5B Fig). Whole-mount examination of DKO embryos between E8.0-E8.5 revealed that the extension and fusion of the allantois were indistinguishable from littermate controls (S6 Fig), suggesting that early events of placental development were unaffected in DKO embryos. However, histological examination of placenta from DKO embryos at E9.5 revealed a strikingly underdeveloped labyrinth layer when compared to littermate controls (Fig 4A and 4B; S2 Table). It has been shown that cell lineage derivatives from placental trophoblast and allantois mesoderm play a critical role in the establishment and maturation of the labyrinth layer [40,42]. Therefore, we next determined whether trophoblast cell specific markers, such as the basic helix-loop-helix transcription factor Hand1, chorionic somatomammotropin hormone 1 (Csh1) and the mammalian Distal-less homolog Dlx3 [43–45], were affected in DKO placentas. Expression of Hand1, Csh1, and Dlx3 could be identified in both DKO and control placentas (S7 Fig), suggesting that trophoblast cell identify was unaffected after IP3R deficiency. However, expression of Dlx3, a specific marker of the trilaminar trophoblast layer, was much more restricted in DKO placentas compared to the controls (S7 Fig), which further highlights the labyrinth defect observed in DKO placentas.
In addition, ultrastructural analysis of DKO placentas at E9.5 revealed the dissociation between fetal allantoic endothelium and syncytiotrophoblast layer III of the trilaminar trophoblast layer (Fig 4C), which was in contrast to the littermate controls, which exhibited an intimate association between the compacted fetal allantoic endothelium and the trilaminar trophoblast layer (Fig 4C), suggesting that deletion of both IP3R1 and IP3R2 in mice is required for maintaining the chorio-allantoic integrity.
Epiblast-specific deletion of IP3R1 in IP3R2 null background results in embryonic lethality and placental defects
We next determined whether IP3Rs within cells from epiblast lineages, which give rise to the allantois, chorionic mesoderm, and embryo [46–48], were required for embryonic viability. We thus ablated IP3R1 in IP3R2 null background utilizing Meox2-Cre, which is active in cells of the epiblast, but is not active in primitive endoderm or trophectoderm [25]. Consistently, cell lineage tracing analysis at E9.5 Meox2-Cre/Rosa-LacZ embryos and placentas revealed that Meox2-Cre activity was highly efficient in all cells of E9.5 embryos including extraembryonic vascular and mesenchymal cells, and chorionic mesoderm, but not in extraembryonic trophoblast cells (Fig 5A). It is important to note that Meox2-Cre mediated excision of IP3R1 in IP3R2 null (cKOMeox2) mice also resulted in similar but slightly late-onset allantoic-placental phenotypes and embryonic lethality (Fig 5B; Table 2), when compared with global DKO embryos. At E10.5, cKOMeox2 embryos also exhibited a dramatic decrease in the diameter of the umbilical cord (Fig 5B). Furthermore, an underdeveloped labyrinth layer was also observed in placentas of cKOMeox2 embryos at E10.5 when compared to the littermate controls (Fig 5C and 5D). These results all suggested that epiblast cell lineages could, at least partially, account for the phenotype of global IP3R1 and IP3R2 double knockout embryos.
Discussion
In this study, we investigated the role of IP3R1 and IP3R2 in embryonic development and survival using both conventional and tissue-specific gene knockout strategies. We demonstrated that ablation of both IP3R1 and IP3R2 resulted in growth retardation and embryonic lethality at around E10.5. A previous study also showed that deletion of both IP3R1 and IP3R2 caused death of mutant embryos around E10.5 [6]; in a subset of E9.5 DKO embryos which had already developed obvious growth retardation, we observed similar cardiac defects as previously reported [6], including enlarged ventricles and thinner ventricular walls. Our study also revealed no obvious cardiac defects in DKO embryos that did not develop obvious growth retardation at E9.5. Furthermore, our results also demonstrated that cardiac cell-specific deletion of IP3R1 in IP3R2 null background genes did not cause any growth retardation and embryonic lethality, suggesting that IP3R1 and IP3R2 in cardiac cells are dispensable for embryonic development, which also implicated that cardiac defects observed in DKO embryos might be secondary to the allantoic-placental defects observed in DKO embryos.
On the other hand, placental defects strongly correlate with abnormal heart, brain and vascular development, even though the mechanistic relationship between these systems has not been fully understood [17,49]. In our study, allantoic-placental defects could be detected in all DKO embryos, even those without obvious growth retardation, implicating that allantoic-placental defects could precede cardiovascular abnormalities in DKO embryos. These allantoic-placental defects observed in DKO embryos included (1) reduced size of umbilical veins and less umbilical vein plexus in the posterior trunk, (2) smaller umbilical cord and reduced diameter of both umbilical vein and artery, (3) underdeveloped labyrinth layer in the placenta, and (4) diminished connection between endothelium of fetal allantoic capillary and the trilaminar trophoblast layer. All these abnormalities in DKO embryos could lead to insufficient metabolic exchange and eventually embryonic lethality.
It has been suggested that Ca2+ signaling pathways might be involved in regulating the establishment of fetal-maternal connection. PLCδ1/PLCδ3 double-knockout mice exhibited decreased vascularization in the labyrinth layer of the placenta and abnormal proliferation and apoptosis of trophoblasts [50]. Na+-Ca2+ exchanger 1 (NCX1), a key plasma membrane Ca2+ transporter, was also involved in both cardiac and placental development. NCX1 knockout mice developed both cardiac defects and an underdeveloped labyrinth layer [51,52], but it is important to note that cardiac specific-expression of NCX1 in NCX1 knockout mice could only rescue cardiac defects, not placental defects [53]. Furthermore, the study by Uchida et al [7], also showed that double knockout of IP3R1 and IP3R3 caused embryonic lethality at a similar stage to that of our IP3R1 and IP3R2 double knockout mice. Uchida et al also observed that deletion of IP3R1 and IP3R3 resulted in abnormal vascular development in the allantois and disorganized placenta. Although their results suggested that inhibition of IP3Rs in cultured endothelial cells could affect tube formation and cell migration, they did not generate endothelial cell-specific IP3R1 and IP3R3 knockout mice for further characterization. Our results showing no phenotype in mice with deletion of IP3R1 by Tie2-Cre and Flk1-Cre in IP3R2 null background make it unlikely that loss of IP3R1 and IP3R2 in endothelial cells could account for vascular defects observed in the global knockout embryos.
In our present study, we utilized the cell / tissue specific gene deletion strategy to investigate the cell dependent mechanism underlying how IP3R1 and IP3R2 regulate the allantoic-placental development. Firstly, endothelial / hematopoietic cell-specific deletion of IP3R1 in IP3R2 null background did not cause similar developmental defects and embryonic lethality in mice. Secondly, ablation of IP3R1 in IP3R2 null background by Mesp1-Cre, which is mainly expressed in anterior mesoderm targeting multiple cardiovascular lineages [34,35], also did not cause embryonic developmental defect and embryonic death. These results together strongly suggested that vascular abnormalities observed in DKO embryos might be secondary to the allantoic / placental defects. Indeed, expression of all three IP3R subtypes could be found in the placenta, including the allantois, chorion mesoderm, and trophoblast cells. Trophoblast cells are derived from the trophectoderm that constitutes the outer layer of the blastocyst and segregates from the inner cell mass [54], and defects in trophoblast differentiation and function have been shown to cause embryonic lethality [45,55,56]. On the other hand, the inner cell mass gives rise to primitive endoderm (hypoblast) and primitive ectoderm (epiblast), and the latter forms all the fetal tissues, both somatic and germline, as well as the amnion ectoderm and all the extraembryonic mesoderm [46,47]. It is important to note that epiblast-specific deletion of IP3R1 by Meox2-Cre in IP3R2 null background also resulted in similar allantoic-placental defects in mice, even including the slight delay in embryonic death compared to conventional global DKO embryos. Although it remains unclear whether deletion of IP3Rs in trophoblast cells could also contribute to the developmental abnormalities observed in DKO embryos, our results have at least demonstrated that IP3R1 and IP3R2 in epiblast cell lineages are required for normal embryonic development and survival. It is worthy to note that deletion of IP3R1 by Meox2-Cre but not Mesp1-Cre in IP3R2 null background could cause allantoic-placental defects and embryonic lethality. Mesp1-Cre activity has been shown to partially overlap with that of Meox2-Cre [24,25,35], but our cell lineage tracing also revealed that the latter could target both allantois-derived extraembryonic mesenchymal cells and chorionic mesoderm more efficiently. In this context, it will be very interesting, in future studies, to investigate whether IP3Rs in allantois-derived cells or chorionic mesoderm could account for the allantoic-placental defects in the DKO embryos.
Supporting information
S1 Fig [tif]
Expression of IPR subtypes in mouse embryos at early developmental stages.
S2 Fig [tif]
Characterization of mRNA levels in conditional gene knockout mouse models.
S3 Fig [a]
Deletion of IPR1 by Mesp1-Cre in IPR2 null background does not alter embryonic development.
S4 Fig [tif]
Quantitative analysis of vascular development in control and DKO embryos.
S5 Fig [a]
Expression of IPR subtypes in mouse placentas at early developmental stages.
S6 Fig [tif]
Macroscopic assessment of allantois extension and fusion in DKO mouse embryos.
S7 Fig [tif]
Expression of trophoblast cell-specific marker in control and DKO placentas.
S1 Table [p1]
Genotypic analysis of embryos for generation of cell / tissue specific IPR1 and IPR2 knockout mice.
S2 Table [docx]
Summary of embryonic phenotypes observed in IPR1 and IPR2 double knockout embryos between E9.5 and E11.5.
Zdroje
1. Berridge MJ. Inositol trisphosphate and calcium signalling. Nature. 1993;361(6410):315–25. doi: 10.1038/361315a0 8381210.
2. Foskett JK, White C, Cheung K-H, Mak D-OD. Inositol Trisphosphate Receptor Ca2+ Release Channels. Physiological Reviews. 2007;87(2):593–658. doi: 10.1152/physrev.00035.2006 17429043
3. Sakakibara S, Nagata E, Takano H, Matsumoto M, Yamada M, Nakagawa T, et al. Ataxia and epileptic seizures in mice lacking type 1 inositol 1,4,5-trisphosphate receptor. Nature. 1996;379(6561):168–71. doi: 10.1038/379168a0 8538767
4. Hisatsune C, Yasumatsu K, Takahashi-Iwanaga H, Ogawa N, Kuroda Y, Yoshida R, et al. Abnormal Taste Perception in Mice Lacking the Type 3 Inositol 1,4,5-Trisphosphate Receptor. Journal of Biological Chemistry. 2007;282(51):37225–31. doi: 10.1074/jbc.M705641200 17925404
5. Nakazawa M, Uchida K, Aramaki M, Kodo K, Yamagishi C, Takahashi T, et al. Inositol 1,4,5-trisphosphate receptors are essential for the development of the second heart field. Journal of Molecular and Cellular Cardiology. 2011;51(1):58–66. doi: 10.1016/j.yjmcc.2011.02.014 21382375
6. Uchida K, Aramaki M, Nakazawa M, Yamagishi C, Makino S, Fukuda K, et al. Gene knock-outs of inositol 1,4,5-trisphosphate receptors types 1 and 2 result in perturbation of cardiogenesis. PloS one. 2010;5(9):e12500. doi: 10.1371/journal.pone.0012500 20824138
7. Uchida K, Nakazawa M, Yamagishi H, Yamagishi C, Mikoshiba K. Type 1 and 3 inositol trisphosphate receptors are required for extra-embryonic vascular development. Developmental Biology. 2016;418(1):89–97. doi: 10.1016/j.ydbio.2016.08.007 27514653
8. Futatsugi A, Nakamura T, Yamada MK, Ebisui E, Nakamura K, Uchida K, et al. IP3 receptor types 2 and 3 mediate exocrine secretion underlying energy metabolism. Science (New York, NY). 2005;309(5744):2232–4. doi: 10.1126/science.1114110 16195467
9. Ouyang K, Leandro Gomez-Amaro R, Stachura DL, Tang H, Peng X, Fang X, et al. Loss of IP3R-dependent Ca2+ signalling in thymocytes leads to aberrant development and acute lymphoblastic leukemia. Nature communications. 2014;5(1):4814–. doi: 10.1038/ncomms5814 25215520
10. Tang H, Wang H, Lin Q, Fan F, Zhang F, Peng X, et al. Loss of IP3 Receptor–Mediated Ca2+ Release in Mouse B Cells Results in Abnormal B Cell Development and Function. The Journal of Immunology. 2017;199(2):570–80. doi: 10.4049/jimmunol.1700109 28615414
11. Wang H, Jing R, Trexler C, Li Y, Tang H, Pan Z, et al. Deletion of IP3R1 by Pdgfrb-Cre in mice results in intestinal pseudo-obstruction and lethality. J Gastroenterol. 2019;54(5):407–18. doi: 10.1007/s00535-018-1522-7 30382364.
12. Lin Q, Zhao G, Fang X, Peng X, Tang H, Wang H, et al. IP3 receptors regulate vascular smooth muscle contractility and hypertension. JCI Insight. 2016;1(17). doi: 10.1172/jci.insight.89402 27777977
13. Lin Q, Zhao L, Jing R, Trexler C, Wang H, Li Y, et al. Inositol 1,4,5-Trisphosphate Receptors in Endothelial Cells Play an Essential Role in Vasodilation and Blood Pressure Regulation. J Am Heart Assoc. 2019;8(4):e011704. doi: 10.1161/JAHA.118.011704 30755057; PubMed Central PMCID: PMC6405661.
14. Mery A, Aimond F, Menard C, Mikoshiba K, Michalak M, Puceat M. Initiation of embryonic cardiac pacemaker activity by inositol 1,4,5-trisphosphate-dependent calcium signaling. Mol Biol Cell. 2005;16(5):2414–23. doi: 10.1091/mbc.E04-10-0883 15758029; PubMed Central PMCID: PMC1087245.
15. Roderick HL, Bootman MD. Pacemaking, arrhythmias, inotropy and hypertrophy: the many possible facets of IP3 signalling in cardiac myocytes. J Physiol. 2007;581(Pt 3):883–4. doi: 10.1113/jphysiol.2007.133819 17446217; PubMed Central PMCID: PMC2170819.
16. Hemberger M, Hanna CW, Dean W. Mechanisms of early placental development in mouse and humans. Nat Rev Genet. 2019. doi: 10.1038/s41576-019-0169-4 31534202.
17. Burton GJ, Jauniaux E. Development of the Human Placenta and Fetal Heart: Synergic or Independent? Frontiers in physiology. 2018;9 : 373. doi: 10.3389/fphys.2018.00373 29706899
18. Copp AJ. Death before birth: clues from gene knockouts and mutations. Trends Genet. 1995;11(3):87–93. doi: 10.1016/S0168-9525(00)89008-3 7732578.
19. Cooley N, Ouyang K, McMullen JR, Kiriazis H, Sheikh F, Wu W, et al. No contribution of IP3-R(2) to disease phenotype in models of dilated cardiomyopathy or pressure overload hypertrophy. Circ Heart Fail. 2013;6(2):318–25. doi: 10.1161/CIRCHEARTFAILURE.112.972158 23258573; PubMed Central PMCID: PMC4028972.
20. Wang YJ, Huang J, Liu W, Kou X, Tang H, Wang H, et al. IP3R-mediated Ca2+ signals govern hematopoietic and cardiac divergence of Flk1+ cells via the calcineurin-NFATc3-Etv2 pathway. J Mol Cell Biol. 2017;9(4):274–88. doi: 10.1093/jmcb/mjx014 28419336.
21. Jiao K, Kulessa H, Tompkins K, Zhou Y, Batts L, Baldwin HS, et al. An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes Dev. 2003;17(19):2362–7. doi: 10.1101/gad.1124803 12975322; PubMed Central PMCID: PMC218073.
22. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230(2):230–42. doi: 10.1006/dbio.2000.0106 11161575.
23. Motoike T, Markham DW, Rossant J, Sato TN. Evidence for novel fate of Flk1+ progenitor: contribution to muscle lineage. Genesis. 2003;35(3):153–9. doi: 10.1002/gene.10175 12640619.
24. Saga Y, Miyagawa-Tomita S, Takagi A, Kitajima S, Miyazaki Ji, Inoue T. MesP1 is expressed in the heart precursor cells and required for the formation of a single heart tube. Development. 1999;126(15):3437. 10393122
25. Tallquist MD, Soriano P. Epiblast-restricted Cre expression in MORE mice: a tool to distinguish embryonic vs. extra-embryonic gene function. Genesis. 2000;26(2):113–5. doi: 10.1002/(sici)1526-968x(200002)26 : 2<113::aid-gene3>3.0.co;2-2 10686601.
26. Fan F, Duan Y, Yang F, Trexler C, Wang H, Huang L, et al. Deletion of heat shock protein 60 in adult mouse cardiomyocytes perturbs mitochondrial protein homeostasis and causes heart failure. Cell Death Differ. 2019. Epub 2019/06/19. doi: 10.1038/s41418-019-0374-x 31209364.
27. Lin Q, Zhao G, Fang X, Peng X, Tang H, Wang H, et al. IP3 receptors regulate vascular smooth muscle contractility and hypertension. JCI Insight. 2016;1(17):e89402 Epub 2016/10/26. doi: 10.1172/jci.insight.89402 [pii]. 27777977; PubMed Central PMCID: PMC5070959.
28. Duan Y, Wang H, Mitchell-Silbaugh K, Cai S, Fan F, Li Y, et al. Heat shock protein 60 regulates yolk sac erythropoiesis in mice. Cell Death Dis. 2019;10(10):766. doi: 10.1038/s41419-019-2014-2 31601784; PubMed Central PMCID: PMC6786998.
29. Fang X, Stroud MJ, Ouyang K, Fang L, Zhang J, Dalton ND, et al. Adipocyte-specific loss of PPARgamma attenuates cardiac hypertrophy. JCI Insight. 2016;1(16):e89908. doi: 10.1172/jci.insight.89908 27734035; PubMed Central PMCID: PMC5053146.
30. Simmons DG, Fortier AL, Cross JC. Diverse subtypes and developmental origins of trophoblast giant cells in the mouse placenta. Dev Biol. 2007;304(2):567–78. doi: 10.1016/j.ydbio.2007.01.009 17289015.
31. Fang X, Bogomolovas J, Zhou PS, Mu Y, Ma X, Chen Z, et al. P209L mutation in Bag3 does not cause cardiomyopathy in mice. Am J Physiol Heart Circ Physiol. 2019;316(2):H392–H9. doi: 10.1152/ajpheart.00714.2018 30499714; PubMed Central PMCID: PMC6397380.
32. Zhang Z, Mu Y, Zhang J, Zhou Y, Cattaneo P, Veevers J, et al. Kindlin-2 Is Essential for Preserving Integrity of the Developing Heart and Preventing Ventricular Rupture. Circulation. 2019;139(12):1554–6. doi: 10.1161/CIRCULATIONAHA.118.038383 30883226; PubMed Central PMCID: PMC6424132.
33. Wu T, Mu Y, Bogomolovas J, Fang X, Veevers J, Nowak RB, et al. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proc Natl Acad Sci U S A. 2017;114(45):11956–61. doi: 10.1073/pnas.1713763114 29078393; PubMed Central PMCID: PMC5692592.
34. Saga Y, Hata N, Kobayashi S, Magnuson T, Seldin MF, Taketo MM. MesP1: a novel basic helix-loop-helix protein expressed in the nascent mesodermal cells during mouse gastrulation. Development. 1996;122(9):2769. 8787751
35. Saga Y, Kitajima S, Miyagawa-Tomita S. Mesp1 expression is the earliest sign of cardiovascular development. Trends Cardiovasc Med. 2000;10(8):345–52. doi: 10.1016/s1050-1738(01)00069-x 11369261.
36. Downs KM, Harmann C. Developmental potency of the murine allantois. Development. 1997;124(14):2769–80. 9226448.
37. Basyuk E, Cross JC, Corbin J, Nakayama H, Hunter P, Nait-Oumesmar B, et al. Murine Gcm1 gene is expressed in a subset of placental trophoblast cells. Dev Dyn. 1999;214(4):303–11. doi: 10.1002/(SICI)1097-0177(199904)214 : 4<303::AID-AJA3>3.0.CO;2-B 10213386.
38. Inman KE, Downs KM. The murine allantois: emerging paradigms in development of the mammalian umbilical cord and its relation to the fetus. Genesis. 2007;45(5):237–58. doi: 10.1002/dvg.20281 17440924.
39. Li Y, Behringer RR. Esx1 is an X-chromosome-imprinted regulator of placental development and fetal growth. Nat Genet. 1998;20(3):309–11. doi: 10.1038/3129 9806555.
40. Rossant J, Cross JC. Placental development: lessons from mouse mutants. Nature reviews Genetics. 2001;2(7):538–48. doi: 10.1038/35080570 11433360
41. Watson ED, Cross JC. Development of Structures and Transport Functions in the Mouse Placenta. Physiology. 2005;20(3):180–93. doi: 10.1152/physiol.00001.2005 15888575
42. Watson ED, Cross JC. Development of structures and transport functions in the mouse placenta. Physiology (Bethesda). 2005;20 : 180–93. doi: 10.1152/physiol.00001.2005 15888575.
43. Scott IC, Anson-Cartwright L, Riley P, Reda D, Cross JC. The HAND1 basic helix-loop-helix transcription factor regulates trophoblast differentiation via multiple mechanisms. Mol Cell Biol. 2000;20(2):530–41. doi: 10.1128/mcb.20.2.530-541.2000 10611232; PubMed Central PMCID: PMC85124.
44. Faria TN, Ogren L, Talamantes F, Linzer DI, Soares MJ. Localization of placental lactogen-I in trophoblast giant cells of the mouse placenta. Biol Reprod. 1991;44(2):327–31. doi: 10.1095/biolreprod44.2.327 2009333.
45. Morasso MI, Grinberg A, Robinson G, Sargent TD, Mahon KA. Placental failure in mice lacking the homeobox gene Dlx3. Proc Natl Acad Sci U S A. 1999;96(1):162–7. doi: 10.1073/pnas.96.1.162 9874789; PubMed Central PMCID: PMC15110.
46. Gardner RL. Clonal analysis of early mammalian development. Philos Trans R Soc Lond B Biol Sci. 1985;312(1153):163–78. doi: 10.1098/rstb.1985.0186 2869527.
47. Lawson KA, Meneses JJ, Pedersen RA. Clonal analysis of epiblast fate during germ layer formation in the mouse embryo. Development. 1991;113(3):891–911. 1821858.
48. Downs KM, Temkin R, Gifford S, McHugh J. Study of the murine allantois by allantoic explants. Dev Biol. 2001;233(2):347–64. doi: 10.1006/dbio.2001.0227 11336500.
49. Perez-Garcia V, Fineberg E, Wilson R, Murray A, Mazzeo CI, Tudor C, et al. Placentation defects are highly prevalent in embryonic lethal mouse mutants. Nature. 2018;555(7697):463–8. doi: 10.1038/nature26002 29539633
50. Nakamura Y, Hamada Y, Fujiwara T, Enomoto H, Hiroe T, Tanaka S, et al. Phospholipase C-delta1 and -delta3 are essential in the trophoblast for placental development. Mol Cell Biol. 2005;25(24):10979–88. doi: 10.1128/MCB.25.24.10979-10988.2005 16314520; PubMed Central PMCID: PMC1316982.
51. Cho CH, Kim SS, Jeong MJ, Lee CO, Shin HS. The Na+ -Ca2+ exchanger is essential for embryonic heart development in mice. Mol Cells. 2000;10(6):712–22. doi: 10.1007/s10059-000-0712-2 11211878.
52. Wakimoto K, Kobayashi K, Kuro OM, Yao A, Iwamoto T, Yanaka N, et al. Targeted disruption of Na+/Ca2+ exchanger gene leads to cardiomyocyte apoptosis and defects in heartbeat. J Biol Chem. 2000;275(47):36991–8. doi: 10.1074/jbc.M004035200 10967099.
53. Cho CH, Lee SY, Shin HS, Philipson KD, Lee CO. Partial rescue of the Na+-Ca2+ exchanger (NCX1) knock-out mouse by transgenic expression of NCX1. Exp Mol Med. 2003;35(2):125–35. doi: 10.1038/emm.2003.18 12754417.
54. Knofler M, Haider S, Saleh L, Pollheimer J, Gamage T, James J. Human placenta and trophoblast development: key molecular mechanisms and model systems. Cell Mol Life Sci. 2019;76(18):3479–96. doi: 10.1007/s00018-019-03104-6 31049600; PubMed Central PMCID: PMC6697717.
55. Holmyard D, Lazzarini RA, Cross JC, Fisher SJ, Dawson K, Anson-Cartwright L. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta. Nature Genetics. 2000;25(3):311–4. doi: 10.1038/77076 10888880
56. Li W, Zheng X, Gu JM, Ferrell GL, Brady M, Esmon NL, et al. Extraembryonic expression of EPCR is essential for embryonic viability. Blood. 2005;106(8):2716–22. doi: 10.1182/blood-2005-01-0406 15956290; PubMed Central PMCID: PMC1895308.
Článek vyšel v časopise
PLOS Genetics
2020 Číslo 4
- Masturbační chování žen v ČR − dotazníková studie
- Aceklofenak v léčbě muskuloskeletálních onemocnění – srovnání s dalšími NSAIDs z hlediska účinnosti a bezpečnosti
- Využití diklofenaku ve formě gelu v terapii seboroické keratózy
- Naděje pro diabetiky: transplantace beta-buněk jim jednou nahradí inzulin
- Hraje umělá inteligence v medicíně fér?
-
Všechny články tohoto čísla
- Dynamic localization of SPO11-1 and conformational changes of meiotic axial elements during recombination initiation of maize meiosis
- The plant mobile domain proteins MAIN and MAIL1 interact with the phosphatase PP7L to regulate gene expression and silence transposable elements in Arabidopsis thaliana
- Targeting mitochondrial and cytosolic substrates of TRIT1 isopentenyltransferase: Specificity determinants and tRNA-i6A37 profiles
- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- XPF-ERCC1 protects liver, kidney and blood homeostasis outside the canonical excision repair pathways
- Technical and social issues influencing the adoption of preprints in the life sciences
- The nanophthalmos protein TMEM98 inhibits MYRF self-cleavage and is required for eye size specification
- DNA methylation-mediated repression of exosomal miR-652-5p expression promotes oesophageal squamous cell carcinoma aggressiveness by targeting PARG and VEGF pathways
- Is imprinting the result of “friendly fire” by the host defense system?
- The coordinate actions of calcineurin and Hog1 mediate the stress response through multiple nodes of the cell cycle network
- XPF–ERCC1: Linchpin of DNA crosslink repair
- A missense variant in Mitochondrial Amidoxime Reducing Component 1 gene and protection against liver disease
- Deconstructing cerebellar development cell by cell
- The genomic landscape of undifferentiated embryonal sarcoma of the liver is typified by C19MC structural rearrangement and overexpression combined with TP53 mutation or loss
- Variants encoding a restricted carboxy-terminal domain of SLC12A2 cause hereditary hearing loss in humans
- Molecular genetics of maternally-controlled cell divisions
- Waking up quiescent neural stem cells: Molecular mechanisms and implications in neurodevelopmental disorders
- Parallelism in eco-morphology and gene expression despite variable evolutionary and genomic backgrounds in a Holarctic fish
- An integrated analysis of cell-type specific gene expression reveals genes regulated by REVOLUTA and KANADI1 in the Arabidopsis shoot apical meristem
- Discovery of novel hepatocyte eQTLs in African Americans
- Loss-of-function tolerance of enhancers in the human genome
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum
- Relaxed constraint and functional divergence of the progesterone receptor (PGR) in the human stem-lineage
- Is adaptation limited by mutation? A timescale-dependent effect of genetic diversity on the adaptive substitution rate in animals
- Tryptamine accumulation caused by deletion of MrMao-1 in Metarhizium genome significantly enhances insecticidal virulence
- Postglacial migration shaped the genomic diversity and global distribution of the wild ancestor of lager-brewing hybrids
- Conserved nuclear hormone receptors controlling a novel plastic trait target fast-evolving genes expressed in a single cell
- Pathological mechanism and antisense oligonucleotide-mediated rescue of a non-coding variant suppressing factor 9 RNA biogenesis leading to hemophilia B
- Loss of FOXM1 in macrophages promotes pulmonary fibrosis by activating p38 MAPK signaling pathway
- Ribosome binding protein GCN1 regulates the cell cycle and cell proliferation and is essential for the embryonic development of mice
- Inference of past demography, dormancy and self-fertilization rates from whole genome sequence data
- Drosophila NUAK functions with Starvin/BAG3 in autophagic protein turnover
- FANCJ helicase promotes DNA end resection by facilitating CtIP recruitment to DNA double-strand breaks
- Getting clear about the F-word in genomics
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Placental imprinting: Emerging mechanisms and functions
- Eliciting priors and relaxing the single causal variant assumption in colocalisation analyses
- Mutations in SPATA13/ASEF2 cause primary angle closure glaucoma
- Functional diversification of Paramecium Ku80 paralogs safeguards genome integrity during precise programmed DNA elimination
- Integrative and quantitative view of the CtrA regulatory network in a stalked budding bacterium
- Analysis of genes within the schizophrenia-linked 22q11.2 deletion identifies interaction of night owl/LZTR1 and NF1 in GABAergic sleep control
- Interaction between host genes and Mycobacterium tuberculosis lineage can affect tuberculosis severity: Evidence for coevolution?
- Quantitative live imaging of Venus::BMAL1 in a mouse model reveals complex dynamics of the master circadian clock regulator
- O-linked β-N-acetylglucosamine transferase plays an essential role in heart development through regulating angiopoietin-1
- The Drosophila FUS ortholog cabeza promotes adult founder myoblast selection by Xrp1-dependent regulation of FGF signaling
- The transcription and export complex THO/TREX contributes to transcription termination in plants
- Loss of Cdc13 causes genome instability by a deficiency in replication-dependent telomere capping
- Leveraging gene co-expression patterns to infer trait-relevant tissues in genome-wide association studies
- Fluorescence fluctuation analysis reveals PpV dependent Cdc25 protein dynamics in living embryos
- Correction: Exome sequencing in multiple sclerosis families identifies 12 candidate genes and nominates biological pathways for the genesis of disease
- C9orf72/ALFA-1 controls TFEB/HLH-30-dependent metabolism through dynamic regulation of Rag GTPases
- Inositol 1,4,5-trisphosphate receptors are essential for fetal-maternal connection and embryo viability
- ArdC, a ssDNA-binding protein with a metalloprotease domain, overpasses the recipient hsdRMS restriction system broadening conjugation host range
- The Drosophila actin nucleator DAAM is essential for left-right asymmetry
- Translesion synthesis polymerases are dispensable for C. elegans reproduction but suppress genome scarring by polymerase theta-mediated end joining
- Juvenile hormone suppresses aggregation behavior through influencing antennal gene expression in locusts
- UNBRANCHED3 Expression and Inflorescence Development is Mediated by UNBRANCHED2 and the Distal Enhancer, KRN4, in Maize
- Dynamic miRNA-mRNA interactions coordinate gene expression in adult Anopheles gambiae
- Long noncoding RNA PAHAL modulates locust behavioural plasticity through the feedback regulation of dopamine biosynthesis
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle
- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Molecular genetics of maternally-controlled cell divisions
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum