() and Its Regulated Homeodomain Gene Mediate Abscisic Acid Response in

The phytohormone abscisic acid (ABA) is an important regulator of plant development and response to environmental stresses. In this study, we identified two ABA overly sensitive mutant alleles in a gene encoding Auxin Response Factor2 (ARF2). The expression of ARF2 was induced by ABA treatment. The arf2 mutants showed enhanced ABA sensitivity in seed germination and primary root growth. In contrast, the primary root growth and seed germination of transgenic plants over-expressing ARF2 are less inhibited by ABA than that of the wild type. ARF2 negatively regulates the expression of a homeodomain gene HB33, the expression of which is reduced by ABA. Transgenic plants over-expressing HB33 are more sensitive, while transgenic plants reducing HB33 by RNAi are more resistant to ABA in the seed germination and primary root growth than the wild type. ABA treatment altered auxin distribution in the primary root tips and made the relative, but not absolute, auxin accumulation or auxin signal around quiescent centre cells and their surrounding columella stem cells to other cells stronger in arf2-101 than in the wild type. These results indicate that ARF2 and HB33 are novel regulators in the ABA signal pathway, which has crosstalk with auxin signal pathway in regulating plant growth.

Published in the journal: . PLoS Genet 7(7): e32767. doi:10.1371/journal.pgen.1002172
Category: Research Article
doi: 10.1371/journal.pgen.1002172


The phytohormone abscisic acid (ABA) is an important regulator of plant development and response to environmental stresses. In this study, we identified two ABA overly sensitive mutant alleles in a gene encoding Auxin Response Factor2 (ARF2). The expression of ARF2 was induced by ABA treatment. The arf2 mutants showed enhanced ABA sensitivity in seed germination and primary root growth. In contrast, the primary root growth and seed germination of transgenic plants over-expressing ARF2 are less inhibited by ABA than that of the wild type. ARF2 negatively regulates the expression of a homeodomain gene HB33, the expression of which is reduced by ABA. Transgenic plants over-expressing HB33 are more sensitive, while transgenic plants reducing HB33 by RNAi are more resistant to ABA in the seed germination and primary root growth than the wild type. ABA treatment altered auxin distribution in the primary root tips and made the relative, but not absolute, auxin accumulation or auxin signal around quiescent centre cells and their surrounding columella stem cells to other cells stronger in arf2-101 than in the wild type. These results indicate that ARF2 and HB33 are novel regulators in the ABA signal pathway, which has crosstalk with auxin signal pathway in regulating plant growth.


Abscisic acid regulates many important aspects including seed development, dormancy, germination, vegetative growth, and plant responses to environmental stresses [1]. ABA is required for normal plant growth as ABA-deficient mutants reduce cell vigor and are usually smaller [2]. Different developmental stages of Arabidopsis seedlings exhibit different response to ABA. In the early germination stage for establishing embryonic axis, the seed germination and post-germination growth are more sensitive to ABA (during 48 hr after seed imbibition) than other stages and more than 3 µM ABA will block the germination and post-germination growth [3], [4]. Genetic screening during this stage has been performed and identified some specific ABA responsive factors such as ABA INSENSITIVE3 (ABI3) and ABI5, which play critical roles in regulating seedling growth mainly during seed germination and post-germination growth period [5], [6]. However, after more than 48 hr of seed imbibition, higher concentrations of ABA are needed to inhibit seedling growth [1]. Recent studies have identified four core components in the ABA signaling pathway, which include soluble PYR1/PYL/RCAR ABA receptors, PP2C phosphatases, SnRK2 kinases and ABA-responsive transcriptional factors for gene regulation or SLAC1 and other channels for regulating guard cell movement, indicating a relative simple and short regulating pathway [7][12]. The SnRK2 (sucrose non-fermenting 1-related protein kinase) triple mutants and the dominant abi1-1 and abi2-1 mutants show insensitive to ABA in all ABA responses including seed germination, seedling growth and guard cell movement [4], [13][15]. Low concentrations of ABA promote root growth through the promotion of the quiescent centre quiescence and the suppression of stem cell differentiation [16]. However, high concentrations of ABA can inhibit root growth through inhibiting cell division [17], [18]. Some DNA replication related mutants are hypersensitive to ABA in seed germination and seedling growth, suggesting that ABA signal might inhibit cell division through regulating the DNA replication related proteins [18].

In order to find the new genes in ABA response, we performed a genetic screen by using ABA inhibiting root growth phenotype [18][20]. Here we identified two ARF2 mutant alleles that were hypersensitive to ABA in both seed germination and primary root growth. ARF2 directly regulates the expression of a homeodomain gene HB33. Our data indicate that ARF2 is a negative, and HB33 is a positive regulator in ABA mediating seed germination and primary root growth.


arf2 mutants are more sensitive to ABA than the wild type in both seed germination and root growth

The sensitivity of seed germination on ABA has been used to identify some classic ABA sensitive and ABA insensitive mutants [4]. In order to find more new ABA responsive mutants, we take advantage of root growth sensitivity to ABA as a selection standard. 5-day seedlings grown on MS were transferred to MS medium supplemented with 30 µM ABA, and the mutants whose root growth is slower than the wild type were selected after growing for 7 days. From an ethyl methyl sulfonate-mutagenized Arabidopsis Columbia M2 population [18], [20], we identified two mutants whose primary root growth is hypersensitive to ABA. Genetic analysis indicates that the two mutants were caused by different recessive mutations in the same gene. Because the two mutants showed similar ABA sensitivity and growth phenotypes, we selected one mutant, named arf2-101, for further analysis. This mutant was backcrossed four times with the wild type to remove other possible mutations. For map-based cloning of the ARF2 gene, we used an F2 population obtained from a cross of arf2-101 with the Arabidopsis Landsberg accession. In ARF2/AT5G62000, a G-to-A transition in arf2-101 was identified at the splice junction of the 8th exon and 7th intron, and this transition would produce a premature protein. In another mutant, arf2-102, a TGG-to-TGA (G1125→A1125) transversion of ARF2 was identified in codon 375, and this transversion would cause premature translation termination. The phenotypic characteristics of arf2-101, which included dark green leaves, late flowering, abnormal flower morphology, partial sterility in early formed flowers, and delayed senescence, were similar to those described previously for other arf2 mutant alleles such as arf2-7 (a T-DNA insertion mutant from the Arabidopsis stock center) [21][23].

As primary root growth is much easier to compare than shoot growth, here we mainly focus on the primary root growth inhibition by ABA. We compared the primary root growth of arf2-101 and the wild type with and without ABA treatment; arf2-7 was included for comparison. Seedlings grown for 5 days on MS medium without ABA were transferred to MS medium supplemented with different concentrations of ABA. On MS medium without ABA, primary root growth was similar for arf2-101, arf2-7, and the wild type (Figure 1A). Inhibition of primary root growth by ABA, however, was greater for arf2-101 and arf2-7 than for the wild type. At 5 µM ABA, the relative primary root growth was about 20% in arf2-101 and arf2-7, but more than 65% in the wild type (Figure 1A, 1B). ABA at ≥30 µM almost completely arrested primary root growth of arf2-101 and arf2-7 but only inhibited 60% the wild-type (Figure 1A, 1B). In contrast, primary root growth did not differ between arf2-101 and the wild type when the MS medium contained NaCl (from 50 mM to 150 mM, for salt stress), mannitol (200 to 350 mM, for osmotic stress), LiCl (15 to 30 mM, for ionic toxic stress), or the plant hormone jasmonate (JA), ACC (a precursor for ethylene), brassinosteroid (BR), or gibberellin (GA3) (Figure S1). We also compared the sensitivity of arf2-101 mutant to ABA with the wild type during seed germination and post-germination stage (Figure 1C, 1D). At 0.3 µM ABA, about 40% of arf2-101 and 22% of arf2-7 showed seed germination greening (green cotyledon), while about 85% of wild type showed seed germination greening, indicating that arf2 mutants are more sensitive to ABA than the wild type in the seed germination and post-germination.

<i>arf2</i> mutants are hypersensitive to ABA.
Fig. 1. arf2 mutants are hypersensitive to ABA.
(A,B) Root growth of the wild type (WT), arf2-101, and arf2-7 on MS medium containing different concentrations of ABA. Five-day-old seedlings grown on MS medium were transferred to MS medium containing 0 to 30 µM ABA and were grown for 7 days before being photographed and measured. The dot line indicates the places where the root tips were after just transferring. 30 seedlings were measured in each experiment. Relative root growth represents the root growth of seedlings after treatment with ABA comparing with that without ABA treatment. Three independent experiments were done. Values are means ±SD, **p<0.01. (C,D) Comparison of seed germination greening among the wild type, arf2-101, and arf2-7 on MS medium supplemented with 0, 0.3 and 0.5 µM ABA. Three independent experiments were done. At least 30 seeds were accounted in each of three different plates for each time. Values are means ±SD, **p<0.01.

Combined together, the results indicate that ARF2 is involved in two different ABA responsive stages, i.e. both the earlier stage during seed germination and later developmental stage of root growth.

Expression of ARF2 is induced by ABA, and transgenic plants over-expressing ARF2 are more resistant than the wild type to ABA

To investigate the role of ARF2 in ABA responses, we first measured the effect of ABA on expression of ARF2. In the ARF2 promoter region from −750 to −744, there is a reverse ABF/ABRE binding cis-element (GCCACGT) [24], suggesting that ARF2 expression might be regulated by ABA response factor(s). Two-week-old seedlings were treated with 30 µM ABA for 0–30 h, and total RNAs were extracted and used for qRT-PCR. As shown in Figure 2A, ABA treatment increased the expression of ARF2 (relative to the control without ABA, from about 5 folds at 12 hr to 2 folds at 30 hr). The ABA inducible expression further supports that ARF2 is involved in ABA response.

Overexpression of <i>ARF2</i> increases resistant to ABA.
Fig. 2. Overexpression of ARF2 increases resistant to ABA.
(A) Expression of ARF2 was induced by ABA treatment. Total RNAs extracted from 14-day-old seedlings treated with 30 µM ABA for different times were reversely transcripted and used for qRT-PCR. ACTIN was used as a control. Three biologically independent experiments were done with similar results. The results shown were from one experiment with triple technical repeats. Values are means ±SD. (B) The relative expression of ARF2 in transgenic plants over-expressing ARF2. The relative ARF2 levels in two over-expressing lines, ARF2-Flag OE1 (OE1) and ARF2-Flag OE2 (OE2) with earlier flowering phenotype, were measured by qRT-PCR. ARF2 from the wild type (WT) or arf2-101 were used as controls. The arf2-101 mutation did not affect itself expression. (C,D) Seed germination greening of WT, arf2-101, OE1, and OE2 on MS medium containing different concentrations of ABA. Seeds of the different accessions were imbibed on MS medium plates with or without ABA at 4°C for 2 days before the plates were transferred to 20°C. Three independent experiments were done. At least 30 seeds were accounted in each of three different plates for each time. Values are means ±SD, **p<0.01. (E,F) Relative root growth of WT, arf2-101, and arf2-7 on MS medium containing different concentrations of ABA. Five-day-old seedlings grown on MS medium were transferred to MS medium containing 0, 10 and 30 µM ABA and were grown for 7 days before being photographed and measured. The dot line indicates the places where the root tips were after just transferring. 30 seedlings were measured in each experiment. Relative root growth represents the root growth of seedlings after treatment with ABA comparing with that without ABA treatment. Three independent experiments were done. Values are means ±SD, **p<0.01.

We next determined whether increasing the transcripts of ARF2 influences the ABA sensitivity of the wild type plants. We constructed a super promoter-driven ARF2 that is fused with a flag tag and transferred it to wild-type plants by Agrobacterium-mediated flower dip transformation. Although most transgenic plants overexpressing ARF2-flag showed the arf2 mutant phenotype because of co-suppression as reported previously [23], several independent transgenic lines with high expression of ARF2-flag were obtained. We selected two of these independent high expression transgenic lines for further study. qRT-PCR analysis indicated that ARF2 transcripts were more abundant in the two over-expressing lines than in the wild type or arf2-101 (Figure 2B). As reported previously, two ARF2-flag over-expressing lines flowered earlier and showed leaf senescence earlier than the wild type [23], suggesting that the flag tag did not affect ARF2 function. We analyzed seed germination greening of the ARF2-flag over-expressing lines in response to ABA. Without addition of ABA (Figure 2C and 2D), seed germination greening ratio was similar for the wild type, arf2-101, and the two ARF2 over-expressing lines. With increasing ABA concentration in the medium, however, seed germination greening ratio was much greater in the two ARF2 over-expressing lines than in the wild type or arf2-101; arf2-101 was the most sensitive to ABA. At 0.5 µM ABA, seed germination greening ratio is about 40% in the wild type, about 95% in two overexpressing lines and 10% in arf2-101 (Figure 2D). ARF2-flag over-expressing plants had shorter primary roots, and more lateral roots than the wild type. However, the primary root growth of ARF2 over-expressing lines was more resistant to ABA than the wild type (Figure 2E, 2F). These results indicate that ARF2 negatively regulates ABA inhibition of seed germination and primary root growth.

ARF2 binds to the HB33 promoter and regulates HB33 expression

arf2 mutants decrease transcriptional levels of three ethylene biosynthesis genes (ACS ) in flowers [21] and a senescence-related gene SAG12 (SENESCENCE ASSOCIATED GENE 12) [22]. In both in vitro and in vivo assays, ARF2 negatively regulates the reporter genes under the control of a synthetic promoter with AuxREs (auxin-responsive elements) [23], [25]. In searching for genes regulated by ARF2 from microarray data [21], we found that AT1G75240 encoding HOMEOBOX PROTEIN 33 (HB33) was up-regulated in the arf2 mutant (the average signal was 153 in the wild type and 276 in arf2-6 from three independent repeats) [21]. We confirmed the microarray results by qRT-PCR, which showed that the expression of HB33 was about 1.5 times greater in arf2-101 than in the wild type (Figure 3A). In order to know whether HB33 is also regulated by other ARFs, we compared the HB33 expression of the wild type with arf1, arf6 and arf21 mutant, and did not find the expression difference of HB33 between these mutants and the wild type (Figure 4B), suggesting that HB33 is regulated specially by ARF2. In contrast to the expression of ARF2, the expression of HB33 was inhibited by ABA treatment in the wild type but not in the arf2-101 mutant (Figure 3A). The reduction of HB33 expression by ABA was further confirmed by a time-course experiment (Figure 3C). We also determined that the expression of HB33 was lower in two ARF2-flag overexpressing lines than in the wild type and was not further reduced by ABA treatment (Figure 3A), suggesting that ARF2 represses HB33 expression. It appears that auxin treatment weakly induced the expression of HB33 in the early times in both the wild type and arf2 mutant (Figure 3D). It is likely that ARF2 does not regulate HB33 expression by auxin.

ARF2 binds to the <i>HB33</i> promoter and regulates <i>HB33</i> expression.
Fig. 3. ARF2 binds to the HB33 promoter and regulates HB33 expression.
(A) Expression of HB33 was negatively regulated by ABA and by ARF2. Two-week- old seedlings of the wild type (WT), arf2-101, ARF2-OE1, and ARF2-OE2 were treated with 0 or 30 µM ABA for 12 h. Total RNAs were extracted, reversely transcripted, and used for qRT-PCR. HB33 expression in WT without ABA treatment was used as a standard for normalizing the relative expression level. Three biologically independent experiments were done with the similar results. The shown results are from one experiment with three technical replicates. Values are means ± SD, n = 3. (B) HB33 expression was not affected by ARF1, ARF6 and ARF21. The similar experiments were done as in (A) by using arf1, arf6 and arf21 mutants. Three biologically independent experiments were done with the similar results. The shown results are from one experiment with three technical replicates. Values are means ± SD, n = 3. (C) Time course of HB33 expression in WT. Two-week-old seedlings were treated with 30 µM ABA for different times. The relative expression of HB33 was determined by qRT-PCR. Three biologically independent experiments were done with similar results. The results are from one experiment with three technical replicates. Values are means ± SD, n = 3. (D) The expression of HB33 under IAA treatment. Two-week-old seedlings were treated with 5 µM IAA for different times. The relative expression of HB33 was determined by qRT-PCR. Three biologically independent experiments were done with similar results. The results are from one experiment with three technical replicates. Values are means ± SD, n = 3. (E) Gel-shift analysis of ARF2 N-terminus binding to cis-elements in the promoter of HB33. a, The oligonucleotide sequences of probe and mutated form probe (mProbe) within the HB33 promoter used in the EMSA. Underlined letters indicate the sequences of ARF2-recognition motifs (TGTCTC). mProbe: ARF2-recognition motifs in probe were mutated as indicated by small letters. b, Interaction between GST-N-ARF2 protein and biotin-labeled Probe and mProbe by SDS-PAGE analysis of purified GST-N-terminus ARF2 fusion protein. Purified protein (6 µg) was incubated with 25 fM biotin-labeled probe or mProbe (mP). For the competition test, non-labeled probe with different concentrations (from 10 to 1000 times) or labeled mP (1000 times) was added in the above experiment.

Chromatin immunoprecipitation (ChIP) assay on the promoter of <i>HB33</i>.
Fig. 4. Chromatin immunoprecipitation (ChIP) assay on the promoter of HB33.
(A) Three pairs of primers were used. Primer pair F2 and R2 covered the promoter region containing AuxRE cis-element. F1 and R1 pair of primers are upstream of AuxRE cis-element, and F3/R3 pair are in the coding region of HB33. (B) Chromatin immunoprecipitation (ChIP) assay on the promoter of HB33. One transgenic line (ARF2-OE1) overexpressing ARF2-Flag and flag antibody were used for the ChIP assay. The wild-type seedlings were used as the negative control. ACTIN, AT4G33680, SAUR-15 and GH3.1 were included in this experiment as controls. Three independent experiments were done with the similar results. Results from one experiment are shown. (C) qRT-PCR of ChIP assay in (B). Three independent experiments were done with similar results, each with triple biological repeats. Data were from one experiment with three technical replicates. Values are means ± SD, n = 3.

AUXIN RESPONSE FACTORs (ARFs) are transcription factors with a conserved N-terminal DNA-binding domain that binds to TGTCTC cis-elements in promoters of auxin-responsive genes [25][27]. In the HB33 promoter region, we found two AuxREs (TGTCTC), one in the position −202∼−197 and the other in the reverse direction (GAGACA) in the position −157∼−152. ARF2 contains the N-terminal DNA-binding domain that targets the AuxREs without the help of a middle or C-terminal part (the middle region for transcriptional activation or repression, and the C-terminal dimerization domain) [25]. We expressed the GST fused with the DNA-binding domain in N-terminus (ARF2-N1-470) in Escherichia coli and purified the fused protein with the help of the GST tag. Gel-shifting was performed to test whether the recombinant protein could bind to the AuxREs. As shown in Figure 3E, a shifted DNA-binding band was detected with addition of GST-ARF2N1-470 and labeled DNA probes, but no band was detected in the GST control. When unlabeled DNA probe was increased gradually in the reaction mixture, the DNA-binding band was abolished. The GST-ARF2 protein, however, did not bind the mutated DNA probes (mP), and the mP did not compete with labeled DNA probes. These results suggest that the ARF2 N-terminal DNA binding domain binds to AuxREs in the promoter of HB33.

We then used the chromatin immunoprecipitation (ChIP) assay to test whether ARF2 could bind to the HB33 promoter in vivo. In this experiment, we used one transgenic line over-expressing ARF2-Flag (OE1) and the wild type as a negative control. Flag antibody was used for ChIP analysis. As shown in Figure 4B, ARF2-Flag bound to the HB33 promoter region, which contains two cis-elements as used in the Gel-shift assay (F2/R2), but could not bind to the gene encoding region (primer pair F3/R3) or to the promoter region that does not contain the AuxRE cis-element (primer pair F1/R1). qRT-PCR results were shown in Figure 4C for each pair of primers (F1R1, F2R2 and F3R3). In theory, all ARF proteins should have ability to bind the AuxREs. However, in vivo, each of ARFs only binds to specific AuxRE in the promoter regions of limited genes. In order to exclude no specific binding of ARF2 to the promoter region, we also included two genes, SAUR-15 and AT4G33680, both of which contain the AuxRE cis-element in their promoter regions, but their expressions are not regulated by ARF2, and the gene GH3.1 which contains the AuxRE cis-element in their promoter region and is regulated by ARF2 [28], as controls. ChIP assay indicated that ARF2 did not bind to the promoter regions of SAUR-15 and AT4G33680, but bound to the promoter region of GH3.1 (Figure 4B, 4C). The results indicate that ARF2 does not bind to all of the AuxRE cis-element regions. ARF2 binding to the promoter of HB33 and GH3.1 in vivo might need the help of other components for its binding specificity [29].

Transgenic plants overexpressing HB33 have an increased sensitivity to ABA in primary root growth inhibition

HB33 in Arabidopsis belongs to a zinc finger-homeodomain (ZF-HD) subfamily containing 14 members that can dimerize with each other in a yeast two-hybrid assay [30]. Most proteins in this family do not have an intrinsic activation domain and might need to interact with other factors for transcriptional activation [30]. We made transgenic plants that over-expressed HB33 under control of a super promoter [31], and qRT-PCR analysis confirmed the higher expression of HB33 in these independent transgenic lines (Figure 5A). We selected two transgenic lines, HB33-OE10 and HB33-OE16, for further study. We tested the seed germination sensitivity of two transgenic lines on MS medium without or with 0.3 or 0.5 µM ABA. As shown in Figure 5B and 5C, no difference in seed germination greening was found among wild type, arf2-101 and two overexpression lines on MS medium without ABA. However, two overexpression lines were more sensitive to ABA than wild type, but less sensitive to ABA than arf2-101 in seed germination. We further compared the effect of ABA on primary root growth of HB33-OE10 and HB33-OE16 lines. Five-day-old seedlings grown on MS medium were transferred to MS medium supplemented with different concentrations of ABA. With all of the tested ABA concentrations (10–50 µM), primary root growth of HB33-OE10 and HB33-OE16 was more sensitive than that of the wild type to ABA, although the sensitivity was still less than that of arf2-101 (Figure 5D, 5E). These results indicate that HB33 overexpression exhibits similar ABA sensitive phenotypes as arf2-101 in seed germination and primary root growth.

Adverse ABA phenotypes of transgenic plants overexpressing <i>HB33</i> and reducing <i>HB33</i> by RNAi.
Fig. 5. Adverse ABA phenotypes of transgenic plants overexpressing HB33 and reducing HB33 by RNAi.
(A) The relative expression of HB33 in different transgenic lines. The wild type (WT) was used as a standard control. OE10 and OE16 were selected for further study. (B,C) Comparison of seed germination greening among WT, arf2-101, HB33 overexpression line OE10 and OE16 on MS medium supplemented with 0, 0.3 and 0.5 µM ABA. Three independent experiments were done. Values are means ±SD, **p<0.01. (D,E) Comparison of relative root growth among WT, arf2-101, OE10 and OE16. Five-day-old seedlings grown on MS medium were transferred to MS medium containing 0, 10, 30 and 50 µM ABA and were grown for 7 days before being photographed and statistics analysis. The dot line in (D) indicates the places where the root tips were after just transferring. 30 seedlings were measured in each experiment. Relative root growth represents the root growth of seedlings after treatment with ABA comparing with that without ABA treatment. Three independent experiments were done. Values are means ±SD, **p<0.01. (F) The relative expression of HB33 in two RNAi transgenic lines (hb33-1 and hb33-2). WT was used as a standard control. (G,H) Comparison of seed germination greening among WT, arf2-101, hb33-1 and hb33-2 on MS medium supplemented with 0, 0.3 and 0.5 µM ABA. Three independent experiments were done. Values are means ±SD, **p<0.01. (I,J) Comparison of relative root growth among WT, arf2-101, hb33-1 and hb33-2. Five-day-old seedlings grown on MS medium were transferred to MS medium containing 0, 10, and 30 µM ABA and were grown for 7 days before being photographed and statistics analysis. The dot line indicates the places where the root tips were after just transferring. Relative root growth represents the root growth of seedlings after treatment with ABA comparing with that without ABA treatment. 30 seedlings were measured in each experiment. Three independent experiments were done. Values are means ±SD, **p<0.01.

HB33 RNAi transgenic plants are more resistant to ABA than the wild type

It appears that ARF2 is a negative regulator, while HB33 is a positive regulator which is controlled by ARF2 in ABA signal pathway. We hypothesize that reducing HB33 would result in ABA resistance. We used a fragment of HB33 which has low homologous sequence with other HB genes and made HB33 RNAi transgenic plants. We took two (hb33-1, hb33-2) from several independent transgenic lines and checked HB33 expression by qRT-PCR. Two RNAi lines had only about 25% HB33 expression of the wild type (Figure 5F). We then compared the ABA sensitivity of hb33-1 and -2 in seed germination and primary root growth with that of the wild type and arf2-101. hb33-1 and hb33-2 were more resistant to ABA than the wild type or arf2-101 in both seed germination and primary root growth (Figure 5G–5J). The results indicate that plants with reducing HB33 show similar ABA phenotypes as plants over-expressing ARF2. However, arf2-101 hb33-1 or arf2-101 hb33-2 double mutants showed ABA sensitive phenotype as arf2-101 mutant (data not shown), indicating that reduced HB33 is required, but not sufficient for suppressing the arf2 mutant phenotype in ABA signaling.

ABA treatment reduces the expression of CYCB1;1 promoter-GUS more in the arf2-101 mutant than in the wild type

Previous studies indicate that ethylene inhibits root growth by retarding cell elongation but not by affecting cell division [32], while ABA inhibits root growth by inhibiting cell division [17], [18]. CYCB1;1 is a G2/M marker protein that might be regulated by PLETHORA2 that is essential for root quiescent center (QC) establishment and stem cell maintenance [33], [34]. We compared CYCB1;1 promoter-GUS expression between the wild type and arf2-101. Under normal growth conditions (i.e., when ABA was not added), GUS expression in the root tips did not clearly differ (Figure 6A, wild type; Figure 6B, arf2-101). Addition of different concentrations of ABA decreased GUS expression in root tips of both the wild type and arf2-101. However, the GUS expression level was decreased more in arf2-101 than in the wild type. At 10 µM ABA, more GUS staining spots were observed in the wild type than in the arf2-101. ABA at ≥30 µM completely inhibited the GUS expression in the arf2-101, but not in the wild type (Figure 6A and 6B). The results indicate that arf2-101 mutants are more sensitive to ABA inhibition of cell division than the wild type.

ABA treatment significantly reduces the expression of <i>CYCB1;1</i> in <i>arf2-101</i> and <i>HB33</i> overexpressing plants.
Fig. 6. ABA treatment significantly reduces the expression of CYCB1;1 in arf2-101 and HB33 overexpressing plants.
(A) Promoter CYCB1;1::GUS expression in the wild type (WT) and arf2-101 with 0, 10, 30 and 50 µM ABA for 36 h. (B) The intensity of GUS coloration was quantified by using Adobe Photoshop CS (Adobe Systems Inc.; San Jose, CA, USA) software. About 10 root tips were measured. The relative intensity without ABA treatment in WT or arf2-101 is considered as 100%. (C) Promoter CYCB1;1::GUS expression in the wild type, arf2-101 and HB33 overexpressing line 10 and 16 (OE10 and OE16) with 0, or 30 µM ABA for 36 h. Red bar = 100 µm. (D) The intensity of GUS coloration was done as in (B). The relative intensity without ABA treatment in WT is considered as 100%.

As plants over-expressing HB33 exhibit a similar ABA sensitive phenotype as arf2 mutant in root growth, we further checked the CYCB1;1::GUS expression pattern in the HB33 over-expressing lines. As shown in Figure 6C and 6D, without ABA treatment, GUS expression was a little less in HB33 OE10 and OE16 than in the wild type or arf2-101. 30 µM ABA treatment for 36 h significantly reduced the expression of CYCB1;1::GUS in two HB33 over-expressing lines (OE10 and OE16). The results suggest that similar to arf2 mutants, HB33 overexpressors are more sensitive to ABA inhibition of cell division than the wild type.

Genetic interaction between arf2 and the classic abi mutations

Many ABA-insensitive mutants have been identified by different screens in Arabidopsis. We crossed arf2-7 (carrying a T-DNA insertion that can be easily used to identify a double mutant) with abi1-1 and abi2-1, two dominant negative mutants, [4], [13], and abi3-1, abi4-1 and abi5-1 mutants [5], [6], [35], and obtained arf2-7 abi1-1, arf2-7 abi2-1, arf2-7 abi3-1, arf2-7 abi4-1 and arf2-7 abi5-1 double mutants. The homozygous double mutants were confirmed by both sequencing of the mutation sites and genetic analysis of F3 and F4 seeds for no segregation. With respect to ABA inhibition of root growth, arf2-7 abi1-1 and arf2-7 abi2-1 had an ABA-insensitive phenotype similar to that of the abi1-1 and abi2-1 single mutants (Figure 7), while arf2-7 abi3-1, arf2-7 abi4-1 and arf2-7 abi5-1 had an ABA-sensitive phenotype similar to arf2-7 mutant, suggesting that the arf2 effect on root growth inhibition by ABA requires the canonical ABA signaling pathway that can be blocked by the dominant abi1 or abi2 mutation, but not by abi3-1, abi4-1 or abi5-1 mutation. Gene expression analyses in these abi mutants indicated that the induction of ARF2 transcripts by ABA treatment was impaired by abi1-1 mutation, partially reduced by abi2-1 mutation, but not affected by abi3-1, abi4-1 or abi5-1 mutation (Figure 7B). Furthermore, ARF2 induction by ABA was not changed in auxin receptor quadruple mutant tir1 afb1 afb2 afb3 [36] (Figure 7C), indicating that ARF2 expression is specially regulated by ABA signaling pathway.

Genetic analysis of <i>arf2-7</i> with <i>abi</i> mutants.
Fig. 7. Genetic analysis of arf2-7 with abi mutants.
(A) Root growth of arf2-7, abi1-1, abi2-1, abi3-1, abi4-1, abi5-1, arf2-7 abi1-1, arf2-7 abi2-1, arf2-7 abi3-1, arf2-7 abi4-1 and arf2-7 abi5-1 on MS medium or MS medium containing 30 µM ABA. Five-day-old seedlings grown on MS medium were transferred to MS medium or MS medium containing 30 µM ABA and grown for 7 days before being photographed. (B) The expression of ARF2 in different abi mutants treated with or without 30 µM ABA for 12 h. Three biologically independent experiments were done with the similar results. The shown results are from one experiment with three technical replicates. Values are means ± SD, n = 3. (C) The expression of ARF2 in the wild type (WT) and tir1 afb1 afb2 abf3 mutant treated with or without 30 µM ABA for 12 h. Three biologically independent experiments were done with the similar results. The shown results are from one experiment with three technical replicates. Values are means ± SD, n = 3.

ABA treatment altered the auxin distribution or auxin signal in the primary root tips

As ARF2 is an auxin response factor, and auxin and ABA have cross talk, we want to know whether the auxin components are changed under ABA treatment in arf2 mutants. We first used the auxin responsive marker IAA2::GUS whose expression is closely related to endogenous auxin [37]. As shown in Figure 8A, under normal condition, there was no much difference of GUS staining (in cells of the QC, columella and the provascular tissue) between arf2-101 and the wild type. ABA treatment reduced IAA2::GUS expression in both arf2-101 and the wild type, but IAA2::GUS expression was reduced more in arf2-101 than in the wild type at different times. IAA2 transcripts by quantitive RT-PCR and the GUS intensity quantified using Adobe Photoshop CS (Adobe Systems Inc.; San Jose, CA, USA) software were consistent with IAA2::GUS expression pattern (Figure 8B, 8C). It appears that relative higher GUS staining was observed around QC and columella stem cells than other cells in arf2-101 (staining for 1 and 3 hr), but not in the wild type. We further checked the expression of DR5, a synthetic promoter with AuxREs that reports auxin response [38]. We introduced DR5::GUS into arf2-101 by crossing a DR5::GUS transgenic plant with arf2-101. Under normal condition, arf2-101 exhibited more GUS staining than the wild type in root tips [in QC cells, columella stem cells, differentiated columella and weak expression in some vascular cells (Figure 8D, 8E, −ABA), suggesting that ARF2 negatively regulates DR5::GUS [23]. ABA treatment reduced GUS expression in both arf2-101 and the wild type. However, we always observed that after ABA treatment, DR5::GUS expression was highly accumulated around QC center, columella stem cells, differentiated columella cells and weak expression in some vascular cells adjacent to the QC in the wild type (Figure 8D, +ABA), but GUS staining in the arf2-101 was not so widely. In arf2-101, GUS staining was highly accumulated around QC and columella stem cells, but neither in vascular cells adjacent to the QC nor in differentiated columella cells (Figure 8D, +ABA). The results suggest that ABA treatment reduces the whole auxin accumulation or auxin response in the root tips of arf2-101 and the wild type, but the relative auxin distribution or auxin signal in the QC and columella stem cells was higher or stronger than other cells in arf2-101, but not in the wild type.

ABA treatment altered the auxin distribution or auxin signal in the root tips.
Fig. 8. ABA treatment altered the auxin distribution or auxin signal in the root tips.
(A) Promoter IAA2::GUS expression patterns in the wild type (WT) and arf2-101. Five-day-old seedlings were transferred to MS medium or MS medium containing 30 µM ABA and treated for different times before GUS staining. GUS staining was performed for 3 h and 1 h in order to see the relative GUS expression. (B) Relative expression of GUS by the intensity of GUS coloration. About 10 root tips were measured. The relative intensity without ABA treatment in the wild type is considered as 100%. (C) The relative expression of IAA2 by qRT-PCR. Total RNAs extracted from root tips (about 1 cm) of WT, arf2-101, HB33 OE10 and OE16 seedlings treated with 30 µM ABA for 36 h were used for qRT-PCR. ACTIN was used as a control. Three biologically independent experiments were done with similar results. The results shown were from one experiment with triple technical repeats. Values are means ±SD. (D) DR5::GUS and proIAA2::GUS expression patterns in WT, arf2-101 as well as two HB33 overexpressing lines OE10 and OE16 without or with ABA treatment. Five-day-old seedlings were transferred to MS medium containing 30 µM ABA for 36 h before GUS staining (DR5::GUS staining for 8 h, proIAA2::GUS staining for 1 h). (E) Relative expression of GUS by the intensity of GUS coloration as determined in (B). 10 root tips were measured. The relative intensity without ABA treatment in WT is considered as 100%. (F) WT and arf2-101 exhibited similar response to NAA and 2,4-D or a low concentration of ABA. Combining 2,4-D or NAA with ABA increased the root growth sensitivity more in arf2-101 than in WT.

We also introduced DR5::GUS or proIAA2::GUS into two HB33 overexpressing lines, OE10 and OE16. In HB33 over-expressing plants, DR5::GUS expression was lower than that in the wild type or arf2-101 under normal condition (Figure 8D and 8E). ABA treatment did not apparently reduce the expression of DR5::GUS in HB33 over-expressing plants (Figure 8D and 8E), but made DR5::GUS accumulated around QC and columella stem cells similar with the GUS distribution in arf2-101. ABA treatment reduced the expression of proIAA2::GUS in HB33 over-expressing plants to a level that was higher than that in arf2-101, lower than that in the wild type, which is consistent with IAA2 transcripts quantified by qRT-PCR (Figure 8C). These results indicate that HB33 over-expressing plants exhibit similar regulation on the expression pattern of DR5::GUS and IAA2 as arf2 mutants.

As ABA treatment reduces auxin accumulation or auxin signal, we want to know whether the arf2-101 sensitivity is due to reduced auxin. We tested the sensitivity of arf2-101 mutant to supplied auxin 1-napthalene acetic acid (NAA) and 2,4-dichlorophenoxy acetic acid (2,4-D). NAA can diffuse through the plasma membrane without the help of auxin carriers, while 2,4-D needs auxin carriers to penetrate the plasma membrane [39]. A low concentration of ABA combined with a low concentration of either 2,4-D or NAA inhibited the primary root growth of both the wild type and arf2-101 more than the same concentration of only ABA, 2,4-D or NAA (Figure 8F). Root growth inhibition by ABA plus auxin was greater in arf2-101 than in the wild type. The results indicate that ABA and auxin have a synergistic effect on inhibiting root growth, and the root ABA sensitivity in arf2-101 is not due to the reduced auxin.

Auxin facilitators are involved in ABA response

Because auxin facilitators affect auxin distribution and thereby mediate root meristem patterning [34], we examined whether PIN2, and AUX1 are involved in ABA mediating root growth. PIN2 is an auxin efflux carrier, and AUX1 is an auxin influx carrier [40][42]. First, we checked expression levels in the arf2 mutant by using PIN2 or AUX1 promoter derived PIN2-GFP or AUX1-YFP transgenic plants. Interestingly, ABA treatment did not change the PIN2-GFP level so much in the wild type (Figure 9A, 9B), but greatly decreased the PIN2-GFP protein in the arf2-101 mutant as well as HB33-OE10 and -OE16 (Figure 9A, 9B). PIN2 is a major regulator of the basipetal auxin transport that controls root meristem cell division [40]. We hypothesize that if the reduced PIN2 expression is the reason for ABA sensitivity, then pin2 mutants should be sensitive to ABA treatment as arf2-101. However, pin2 mutants exhibited similar ABA sensitive phenotypes as wild type in root growth, while arf2-101 pin2 double mutants showed similar ABA sensitive phenotype as arf2-101 in root growth (Figure 9C), indicating that the decreased PIN2 observed in arf2-101 should be resulted from the ABA hyper-response, but is not the reason for ABA sensitivity.

Auxin transport contributes to ABA inhibition of root growth.
Fig. 9. Auxin transport contributes to ABA inhibition of root growth.
Transgenic plants carrying promoter PIN2::PIN2-GFP or promoter AUX1::AUX1-YFP were crossed with arf2-101, HB33-OE10 or HB33-OE16, and homozygous plants of arf2-101, HB33-OE10 or HB33-OE16 with different fused GFP/YFP were identified by PCR and the offspring plants were analyzed. Five-day-old seedlings were transferred to MS medium containing 30 µM ABA for another 36 h before GFP/YFP images were captured with a confocal microscope at the same settings to enable comparison of image strength. 7–8 seedlings were examined for each sample, and similar results were obtained for each seedling within a sample. Values are means ±SD, **p<0.01. Bar = 100 µm. (A) promoter PIN2::PIN2-GFP (B) Relative expression of PIN2 by GFP intensity. (D) Promoter AUX1::AUX1-YFP. (E) Relative expression of AUX1 by YFP intensity. (C) Root growth phenotypes of the wild type (WT), arf2-101, pin2, and arf2-101 pin2 seedlings. Five-day-old seedlings grown on MS medium were transferred to MS medium containing 0 and 30 µM ABA and were grown for 7 days before being photographed. (F) Root growth phenotypes of WT, arf2-101, aux1, and arf2-101 aux1 seedlings. Five-day-old seedlings grown on MS medium were transferred to MS medium containing 0 and 30 µM ABA and were grown for 7 days before being photographed. (G) ProPIN3::PIN3-GFP expression in the wild type and arf2-101 with or without 30 µM ABA treatment for 36 h. Bar = 100 µm. (H) ProPIN7::PIN7-GFP expression in the wild type and arf2-101 with or without 30 µM ABA treatment for 36 h. Bar = 100 µm. (I,J) Effects of different concentrations of the auxin carrier influx inhibitor 1-naphthoxyacetic acid (NOA) on the root growth of WT and arf2-101. 30 seedlings were measured in each experiment. Three independent experiments were done. (K,L) NOA partially releases the ABA sensitivity of arf2-101 under ABA treatment. Relative root growth of seedling treated with ABA, ABA plus NOA. About 30 seedlings were measured. Three independent experiments were done.

PIN2 and AUX1 overlap for the basipetal auxin transport through the outer root cell layers. Besides, AUX1 is also responsible for the phloem-based auxin transport from source leaves to the root basal meristem [43]. For AUX1 expression, we also included HB33 overexpressing lines. ABA treatment decreased the AUX1 to the similar level in the wild type, arf2-101 and two HB33 overexpressing lines (Figure 9D, 9E). In order to know whether auxin transported from phloem affects ABA sensitivity in root tips or not, we examined aux1 mutant. aux1 mutant showed more resistant to ABA in root growth than the wild type (Figure 9F). arf2-101 aux1 double mutant showed phenotype similar to aux1 that is more resistant to ABA than the wild type in root growth (Figure 9F).

Several auxin efflux carrier PINs (PIN3, PIN4 and PIN7) are expressed in QC and columella stem cells to regulate cell division and cell expansion in the primary root [34]. We used PIN3 or PIN7 promoter derived PIN3-GFP or PIN7-GFP to check their expression. Without ABA treatment, arf2-101 and the wild type exhibited the similar expression level of PIN3-GFP or PIN7-GFP. ABA treatment reduced the expression of PIN3-GFP or PIN7-GFP in both the wild type and arf2-101, but the expression of PIN3-GFP or PIN7-GFP was reduced more in arf2-101 than in the wild type (Figure 9G, 9H). These results indicate that the reduced expression of PIN3 and PIN7 might lead to high accumulation of auxin in QC and columella stem cells and inhibit cell division.

NOA is an inhibitor of auxin influx carrier that phenocopies aux1 [44]. NOA concentrations from 30 to 50 µM did not differently affect root growth between arf2-101 and the wild type (Figure 9I, 9J). When different concentrations of NOA were added to the medium, the root growth inhibition by ABA was differentially released, i.e., the inhibition of arf2-101 became similar to that of the wild type (Figure 9K, 9L). These results indicate that inhibition of root growth by ABA in arf2-101 is rescued or alleviated by blocking AUX1 mediating auxin influx, suggesting that ABA mediating root growth is involved in auxin transport.


It has long been known that root growth is inhibited by high levels of ABA, but the molecular mechanism is poorly understood [1], [17]. In our studies, we have used the Columbia accession to study the molecular mechanism of how ABA regulates root growth, and we have identified several new root-sensitive mutants to ABA [18][20], suggesting that our screening is very powerful in identifying new components in ABA response pathway. In the current study, we provide several lines of evidence to show that ARF2 and its regulated gene HB33 are important players in ABA response which has cross talk with auxin response pathway in regulating plant growth.

ARF2 was originally identified as an ARF1 binding protein (ARF1-BP) [26], [38], and could bind to AuxRE target site [45], [46]. Later, ARF2 was isolated as a suppressor that regulates hypocotyl bending of the hookless1 mutant (an ethylene-response mutant), which suggested that ARF2 has an important role in linking ethylene and auxin signaling in the apical hook [23]. ARF2 is a pleiotropic regulator that represses the expression of targeted genes to regulate plant development [21], [22], [47]. Furthermore, brassinosteroid-regulated BIN2 kinase can phosphorylate ARF2, which releases the ARF2 repression activity and thereby increases expression of auxin-induced genes [28]. Here, we found that the expression of ARF2 is induced by ABA, and that ARF2 is a negative regulator in the ABA response pathway controlling seed germination and primary root growth. In contrast, no single ARF gene among the 23 ARF members is a positive regulator in the control of embryonic axis growth by ABA, probably because of functional redundancy among the genes [3]. These results suggest that ARF2 is a central integrator which connects auxin, ethylene, brassinosteroid and ABA signal pathway in controlling the growth and development of different organs and tissues [3], [17], [32], [48], [49].

In the auxin signaling pathway, Aux/IAA proteins dimerize with and inhibit the activities of ARF proteins at low auxin concentrations [50], [51]. At high auxin concentrations, Aux/IAA is degraded by the F-box protein TRANSPORT INHIBITOR RESPONSE1 (TIR1)/AUXIN SIGNALING F-BOX (AFB)-mediated ubiquitination, which releases the inhibition on the ARFs [51]. The released ARFs then target downstream genes. In Arabidopsis, the ARF family has 23 members exhibiting either positive or negative regulatory roles [52]. Study of regulation of ARF10 mRNA stability by miR160 suggested that ARF10 mediates the link between ABA and auxin responsiveness during and after seed germination [53]. Although ARFs are important in plant growth and development, only some of the direct targets of ARFs have been identified [54]. Previous studies have indicated that ARF2 expression is also regulated by miRNAs and/or tasiRNAs [55], [56]. Our data indicate that ARF2 is a transcriptional repressor that directly targets the promoter of HB33 and suppresses the expression of HB33. Consistent with the induced expression of ARF2 by ABA is the suppressed expression of HB33 by ABA. Although many AuxREs exist in the genomic sequence, our ChIP analyses indicate that ARF2 can only bind to some specific promoters including HB33 with AuxREs, suggesting that the targeted sites are determined by both ARF2 and its partner(s). HB33, however, is only one of the genes targeted by ARF2. Our data indicate that ARF2 is a negative regulator in ABA mediating seed germination and root growth as arf2 mutants are sensitive to, and ARF2 over-expressors are resistant to ABA in both seed germination and root growth. In contrast, HB33 is a positive regulator in ABA mediating seed germination and root growth as showed by both HB33 over-expressing and HB33 RNAi study. Our results suggest that ARF2 regulates seed germination and root growth partially through direct repression of HB33 in Arabidopsis. However, reducing the expression of HB33 by RNAi could not rescue the ABA sensitive phenotype of arf2 mutant, suggesting that other components besides HB33 are needed for controlling the ABA response in arf2.

Previous study indicates that ABA has cross talk with ethylene in regulating plant growth [23], [57], [58]. Ethylene insensitive mutant ein2 is recovered as a mutant with enhanced response to ABA in seed germination (named era3) [57], and also from screening the suppressors and enhancers of abi1-1 in seed germination [58]. Interestingly, EIN2 is a negative regulator in seed germination, but a positive regulator in root growth as the root growth of ein2 is more resistant to ABA than that of the wild type [57], [58]. As mentioned above, ARF2 was isolated as a suppressor of the hookless1 mutant [23]. ABI3 encoding a transcriptional factor is induced by auxin in lateral root primordia [59]. The ABA-insensitive abi3 mutant reduces while the ABA-hypersensitive era1 mutant increases the number of lateral roots when exogenous auxin is applied [59], [60]. ABI4 encodes another transcriptional factor that is up-regulated by cytokinin and ABA, but repressed by auxin in roots [61]. These results indicate that ABA and ethylene signal have a cross-talk with auxin signal.

However, the molecular mechanism of ABA inhibition of primary root growth is different from that of ethylene. Addition of ethylene reduces cell elongation, but does not affect cell division, and does not change CYCB1;1 expression [32]. But, addition of ABA reduces cell division and greatly decreases CYCB1;1 expression. Ethylene inhibits root growth by increasing auxin biosynthesis and enhancing the expression of PIN2 and AUX1 [32], [49], [62]. Nevertheless, ABA inhibiting root growth seems mainly through interfering with the distribution of auxin in root tips. ABI4 negatively regulates PIN1 and interferes with auxin distribution to control lateral root growth [61]. Here, we used two marker genes, DR5::GUS and proIAA2::GUS, to examine the gene expression by ABA treatment. Under normal condition, DR5::GUS was expressed at a higher level in arf2-101 than in the wild type, indicating that arf2 mutation results in a stronger auxin response. Although ABA treatment greatly reduced DR5::GUS expression in both wild type and arf2-101 mutant, interestingly, ABA treatment made DR5::GUS accumulated to a relative, but not absolute, higher level around QC center and columella stem cells than other cells comparing with that in normal condition in both wild type and arf2-101. Different from wild type, GUS staining was not observed in differentiated columella cells and some vascular cells in arf2-101, but could be observed in the wild type. ABA treatment also decreased the expression of endogenous auxin responsive marker proIAA2::GUS in both wild type and arf2-101 mutant, but more in arf2-101 than wild type. Again, the relative GUS staining became stronger around QC center and columella stem cells in arf2-101 by ABA treatment comparing with no ABA treatment. Nevertheless, the relative stronger GUS staining was not so apparent in the wild type. These results suggest that ARF2 mutation interferes with auxin distribution and the relative high auxin accumulation or auxin signal around QC and columella stem cells inhibits the cell division in the root tips. HB33 overexpressing plants show the similar ABA sensitive phenotypes as arf2-101. Interestingly, ABA treatment leads to the similar expression patterns of both DR5::GUS and proIAA2::GUS in HB33 overexpressing plants as in arf2 mutant. However, the expression of both DR5::GUS and proIAA2::GUS is lower in HB33 overexpressing plants than in arf2-101, suggesting that arf2 mutation might regulate the expression of other genes besides HB33. Previous study indicate that mutations in some DNA replication related proteins such as DNA polymerase ε (ABO4) and DNA replication A2A (ROR1) or FAS1 lead to ABA hypersensitivity in root growth, suggesting that ABA signal might target DNA replication related proteins for inhibiting DNA replication and cell division [18]. A recent study also shows that ABA treatment reduces the phosphorylation level of DNA replication factor C, suggesting the importance of ABA signal transduction in modifying DNA replication related proteins [63].

Auxin distribution is determined by auxin transporters [39], [64]. Although ABA treatment reduced the expression of the auxin basipetal efflux transporter PIN2 to a lower level in arf2-101 than wild type, our genetic analysis of arf2-101 pin2 double mutant excludes the possibility of PIN2 involving in ABA inhibition of root growth of arf2 mutant, which is different from its roles in mediating ABA repression of embryonic axis elongation under ABA treatment [3]. The reduced PIN2 might be caused by the low auxin or low auxin signal after ABA treatment as PIN2 expression is regulated by auxin homeostasis [34]. AUX1 is a basipetal auxin influx transporter pairing with PIN2, but at the same time it functions in transporting auxin via phloem from source leaves to the root basal meristem [43]. AUX1 expression in roots was decreased by ABA treatment, but AUX1 levels did not differ between the wild type and arf2-101 mutant. Our genetic analysis indicates that AUX1 mutation was able to suppress the ABA sensitivity of root growth of arf2-101, suggesting that auxin transporting from leaves to root tips is important in ABA inhibition of root growth. Interestingly, tow auxin efflux carriers PIN3 and PIN7 are reduced more in arf2 than in the wild type by ABA treatment. PIN3 and PIN7 are key transporters that direct the flow of auxin in root tip [65]. The reduced expression of PIN3 or PIN7 might lead to relative high accumulation of auxin in QC and columella stem cells, which might result in the inhibition of cell division. Although ABA treatment appears to reduce auxin biosynthesis or reduce the whole auxin signal (judged by reduced IAA2::GUS and DR5::GUS), our auxin feeding experiment indicates that auxin and ABA have a synergistic effect on inhibiting root growth, suggesting that the possible reducing whole auxin amount is not a factor for ABA sensitivity. These results further point out the importance of auxin distribution in ABA inhibiting root growth. Previous studies also indicate that ABA inhibits seedling growth through enhancing auxin signaling [3]. Mutations in some auxin components such as AXR2/IAA7 and AUX1 lead plants to be resistant to both ABA and auxin [3], [42], [66], [67]. This synergistic effect requires the canonical ABA signaling pathway, which is blocked by the dominant abi1 or abi2 mutation, but not by abi3, abi4 or abi5 mutation, indicating that the importance of early ABA signaling components in ABA inhibiting root growth.

Materials and Methods

Arabidopsis thaliana (Columbia accession) was used unless noted. The plant materials used in this study were: abi1-1 (Landsberg accession) [4], abi2-1 (Landsberg accession) [68], abi3-1 (Landsberg accession) [69], abi4-1 (Columbia accession) [19], abi5-1 (Columbia accession) [19], tir1 afb1 afb2 afb3 quadruple mutant [36], proCYCB1;1::GUS [18], pin2_151A5.1/CS89461 [70], aux1-2 [71], proDR5::GUS [38], proIAA2::GUS [62], proAUX1-AUX1:YFP [43], and proPIN2-PIN2::GFP [72], proPIN3-PIN3:GFP and proPIN7-PIN7:GFP [34]. The T-DNA insertion mutant arf2-7 (CS24601, AT5G62000), arf1 (CS24599, AT1G59750), arf6 (CS24606, AT1G30330), arf21 (CS24621, AT1G34410) were obtained from the Arabidopsis Stock Center. arf2-101 and arf2-102 mutants were isolated from a screen as described previously [18]. arf2-101 was crossed with Landsberg accession, and mutants from the F2 population were used for mapping (Table S2).

Seeds were sown onto plates containing MS medium supplemented with 3% (w/v) sucrose and 0.8% agar. After 2 d at 4°C, the plates were transferred to a growth chamber at 20°C with a 16-h light/8-h dark cycle. After 7 days, the seedlings were transplanted into soil and were grown in a greenhouse at 20°C under long-day (16-h light/8-h dark) condition.

Transgenic plants

For construction of super promoter-ARF2-flag (in a modified pCAMBIA 1300 vector, superP3101), ARF2 cDNA fragment was obtained using the following primers: 5′- CGCGGGCCCGTATGGCGAGTTCGGAGGTTTCAATG (containing the ApaI site) and 5′- CGGACTAGTAGAGTTCCCAGCGCTGGAC-3′ (containing the SpeI site). ARF2 cDNA amplified from total RNAs isolated from seedlings was fused with a flag tag and constructed into a binary vector superP1300. For super P1300-ATHB33: MYC, ATHB33 cDNA fragment was amplified by the specific primer: 5′-CGCGGGCCCCCATGGATATGAGAAGCCATGAAATGATAGAGAG-3′ (containing the ApaI site) and 5′-GGACTAGTGAGAGTAGTTGTTGGTGTTGGTGG-3′ (containing the SpeI site). The amplified cDNAs were verified by sequencing and were cloned into the binary vector super P1300. The Agrobacterium strain GV3101 carrying the constructs was transformed to Arabidopsis thaliana (Columbia) by the floral dip method. More than 10 independent transgenic lines were selected based on hygromycin B resistance in the T2 and T3 generations. The expression level of the gene in each line was analyzed by real-time PCR using specific primer pairs. Two independent lines were generally used for further study.

We constructed pGreen104-HY104 : HB33 vector to silence HB33 gene expression by double-stranded RNAi. A HB33 cDNA fragment which has low homologous sequence with other HB genes was chose and amplified using two primer pairs: RNAi-75240-F:5′- GCTGCA (Pst1) GAATTC (EcoR1) GGACGGCGTTGGAAGCTCG-3′, RNAi-75240-R:5′- CGGATC (BamH1) CTCGAG (Xho1) CACCAGCTCCTTCTCCGCTTG -3′. In bacteria, the plasmid was selected by Kanamycin. The transgenic plants were selected by Basta. Homozygous lines were identified in T3 generation and used for further study.

Phenotypic analyses

The root-bending assay was previously described [18]. Briefly, Seeds sown on MS plates were first kept at 4°C for 2 days and then transferred to a growth chamber at 22°C for 5 days. Seedlings were transferred to various media containing different plant hormones or chemicals; the seedlings were photographed after 7 days unless a different time period is indicated. Relative root growth represents the root growth of seedlings after treatment with ABA or other chemicals comparing with that without ABA or other chemical treatment.

Purification of recombinant protein and electrophoretic mobility shift assay (EMSA)

The N-terminal of ARF2 which contains DNA binding domain was fused in frame with GST and expressed in E. coli BL21 cell line. The fused protein was induced by 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG), and incubated under 28°C for 6 h. The recombinant protein was purified by GST-agarose affinity. The electrophoresis mobility shift assay (EMSA) was carried out using the LightShift Chemiluminescent EMSA Kit (Pierce, 20148) according to the manufacturer's instructions. The biotin-labeled DNA fragments (5′-CCAAATTGTCTCTTATAATCCGATCTCAAAGGTTGGCTTGTTGGGAGCACTGAGACATCAAAC-3′, 5′-GTTTGATGTCTCAGTGCTCCCAACAAGCCAACCTTTGAGATCGGATTATA AGAGACAATTTGG-3′) and mutated DNA fragments (5′-CCAAATTGaCaCTTATAATCCGATCTCAAAGGTTGGCTTGTTGGGAGCACTGtGtCATCAAAC-3′, 5′-GTTTGATGACACAGTGCTCCCAACAAGCCAACCTTTGAGATCGGATTATAAGTGTCAATTTGG-3′) were synthesized, annealed and used as probes, and the biotin-unlabeled same DNA fragments as competitors in this assay. The probes were incubated with the N-ARF2-GST fused protein at room temperature for 20 mins in a binding buffer (5× concentration: 50 mM HEPES-KOH [pH 7.5], 375 mM KCl, 6.25 mM MgCl, 1 mM DTT, 0.5 µg/mL BSA, Glycerol 25%). Each 20 µl binding reaction containing 25 fmol Biotin-probe, 6 µg protein, and 1 µg Poly (dI·dC) was supplemented to the reaction to minimize nonspecific interactions. The reaction products were analyzed by 6.5% native polyacrylamide gel electrophoresis. Electrophoresis was performed at 120 V for about 1 h in TGE buffer (containing 12.5 mM Tris, 95 mM glycin, 0.5 mM EDTA, pH 8.3, precooled at −10°C). The DNA fragments on gel were transferred onto nitrocellulose membrane with 0.5XTBE at 100 V (∼380 mA) for 40 mins at 4°C. After cross-linking the transferred DNA to membrane, the membrane was incubated in the blocking buffer for 15 mins with gently shaking, then transferred to conjugate/blocking buffer by mixing 33.3 µl stabilized Streptavidin-Horseradish Peroxidase Conjugate with 10 ml blocking buffer according to manufacture's protocol (no detail information for the blocking buffer is provided in the kit). The membrane was washed 6 times, each for 5 mins with a washing buffer. Biotin-labeled DNA was detected by the chemiluminescent method according to the manufacture's protocol.

Chromatin immuno-precipitation (ChIP) analysis

The transgenic lines over-expressing ARF2-Flag were used in this assay. ChIP was performed on 2-week-old seedlings growing on MS plates as described previously [73]. Flag tag-specific monoclonal antibody was used for ChIP analysis. Wild-type plants were treated in the same way and served as the control. The ChIP DNA products were analyzed by PCR using three pairs of primers that were synthesized to amplify about 200-bp DNA fragments in the promoter region or coding region of HB33 or other genes used in ChIP analysis. The primer sequences were listed in Figure S3 (Table S1). The experiment was repeated three times, and similar results were obtained each time.

RNA extraction and quantitative RT–PCR

Two-week-old seedlings on MS plates were used for extraction of total RNAs. Real-time RT-PCR was performed as described previously to determine the relative expression levels of ARF2 or HB33 [18]. The gene-specific primers used for real-time PCR were: RT-ARF2-F: 5′- CCTCATCCGAAGGATGCTCAA ACG -3′, RT-ARF2-R: 5′- GGAGCCATCAACTCTCCATTG AACTC -3′; RT-HB33-F: 5′-GGACAATCAAGCGGAGAAGGAGC-3′; RT-HB33-R: 5′-CTCCGATCTCGCCGCAGAATCTC-3′. All experiments were independently repeated at least three times, each with triplicates.

Histochemical GUS analysis

The transgenic plants carrying proDR5::GUS, proIAA2::GUS, proCYCB1;1::GUS HB33-OE10 or HB33-OE16 were crossed with the arf2-101 mutant, and F2 seedlings were selected on kanamycin and transferred to soil after 1 week. Plants that showed the arf2-101 growth phenotype were harvested and rechecked for other markers. Expression analysis of the GUS reporter gene was performed as described previously [18].

Confocal microscopy

Five-day-old seedlings carrying proAUX1-AUX1::YFP, proPIN2-PIN2::GFP, proPIN3-PIN3:GFP or proPIN7-PIN7:GFP were transferred to MS medium supplemented with 30 µM ABA for another 36 h. The roots were examined by confocal microscopy and photographed with the same settings to enable comparison of image strength.

Supporting Information

Attachment 1

Attachment 2

Attachment 3


1. FinkelsteinRRGampalaSSRockCD 2002 Abscisic acid signaling in seeds and seedlings. Plant Cell 14 Suppl S15 45

2. XiongLZhuJK 2003 Regulation of abscisic acid biosynthesis. Plant Physiol 133 29 36

3. BelinCMegiesCHauserovaELopez-MolinaL 2009 Abscisic Acid Represses Growth of the Arabidopsis Embryonic Axis after Germination by Enhancing Auxin Signaling. Plant Cell

4. MeyerKLeubeMPGrillE 1994 A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264 1452 1455

5. FinkelsteinRRLynchTJ 2000 The Arabidopsis abscisic acid response gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell 12 599 609

6. GiraudatJHaugeBMValonCSmalleJParcyF 1992 Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell 4 1251 1261

7. KlinglerJPBatelliGZhuJK 2010 ABA receptors: the START of a new paradigm in phytohormone signalling. J Exp Bot 61 3199 3210

8. CutlerSRRodriguezPLFinkelsteinRRAbramsSR 2010 Abscisic acid: emergence of a core signaling network. Annu Rev Plant Biol 61 651 679

9. HubbardKENishimuraNHitomiKGetzoffEDSchroederJI 2010 Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes Dev 24 1695 1708

10. LeeSCLanWBuchananBBLuanS 2009 A protein kinase-phosphatase pair interacts with an ion channel to regulate ABA signaling in plant guard cells. Proc Natl Acad Sci U S A 106 21419 21424

11. GeigerDScherzerSMummPStangeAMartenI 2009 Activity of guard cell anion channel SLAC1 is controlled by drought-stress signaling kinase-phosphatase pair. Proc Natl Acad Sci U S A 106 21425 21430

12. FujiiHChinnusamyVRodriguesARubioSAntoniR 2009 In vitro reconstitution of an abscisic acid signalling pathway. Nature 462 660 664

13. LeungJMerlotSGiraudatJ 1997 The Arabidopsis ABSCISIC ACID-INSENSITIVE2 (ABI2) and ABI1 genes encode homologous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell 9 759 771

14. FujiiHZhuJK 2009 Arabidopsis mutant deficient in 3 abscisic acid-activated protein kinases reveals critical roles in growth, reproduction, and stress. Proc Natl Acad Sci U S A 106 8380 8385

15. NakashimaKFujitaYKanamoriNKatagiriTUmezawaT 2009 Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. Plant Cell Physiol 50 1345 1363

16. ZhangHHanWDe SmetITalboysPLoyaR 2010 ABA promotes quiescence of the quiescent centre and suppresses stem cell differentiation in the Arabidopsis primary root meristem. Plant J 64 764 774

17. HimmelbachAItenMGrillE 1998 Signalling of abscisic acid to regulate plant growth. Philos Trans R Soc Lond B Biol Sci 353 1439 1444

18. YinHZhangXLiuJWangYHeJ 2009 Epigenetic regulation, somatic homologous recombination, and abscisic acid signaling are influenced by DNA polymerase epsilon mutation in Arabidopsis. Plant Cell 21 386 402

19. LiuYHeJChenZXiaozhiRHongX 2010 ABA Overly-Sensitive5 (ABO5), encoding a pentatricopeptide repeat protein required for cis-splicing of mitochondrial nad2 intron 3, is involved in abscisic acid response in Arabidopsis. Plant J In press

20. ZhouXHuaDChenZZhouZGongZ 2009 Elongator mediates ABA responses, oxidative stress resistance and anthocyanin biosynthesis in Arabidopsis. Plant J

21. OkushimaYMitinaIQuachHLTheologisA 2005 AUXIN RESPONSE FACTOR 2 (ARF2): a pleiotropic developmental regulator. Plant J 43 29 46

22. EllisCMNagpalPYoungJCHagenGGuilfoyleTJ 2005 AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development 132 4563 4574

23. LiHJohnsonPStepanovaAAlonsoJMEckerJR 2004 Convergence of signaling pathways in the control of differential cell growth in Arabidopsis. Dev Cell 7 193 204

24. ChoiHHongJHaJKangJKimSY 2000 ABFs, a family of ABA-responsive element binding factors. J Biol Chem 275 1723 1730

25. TiwariSBHagenGGuilfoyleT 2003 The roles of auxin response factor domains in auxin-responsive transcription. Plant Cell 15 533 543

26. UlmasovTHagenGGuilfoyleTJ 1997 ARF1, a transcription factor that binds to auxin response elements. Science 276 1865 1868

27. GuilfoyleTJHagenG 2007 Auxin response factors. Curr Opin Plant Biol 10 453 460

28. VertGWalcherCLChoryJNemhauserJL 2008 Integration of auxin and brassinosteroid pathways by Auxin Response Factor 2. Proc Natl Acad Sci U S A 105 9829 9834

29. HagenGGuilfoyleT 2002 Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49 373 385

30. TanQKIrishVF 2006 The Arabidopsis zinc finger-homeodomain genes encode proteins with unique biochemical properties that are coordinately expressed during floral development. Plant Physiol 140 1095 1108

31. GongZLeeHXiongLJagendorfAStevensonB 2002 RNA helicase-like protein as an early regulator of transcription factors for plant chilling and freezing tolerance. Proc Natl Acad Sci U S A 99 11507 11512

32. RuzickaKLjungKVannesteSPodhorskaRBeeckmanT 2007 Ethylene regulates root growth through effects on auxin biosynthesis and transport-dependent auxin distribution. Plant Cell 19 2197 2212

33. AidaMBeisDHeidstraRWillemsenVBlilouI 2004 The PLETHORA genes mediate patterning of the Arabidopsis root stem cell niche. Cell 119 109 120

34. BlilouIXuJWildwaterMWillemsenVPaponovI 2005 The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433 39 44

35. FinkelsteinRRWangMLLynchTJRaoSGoodmanHM 1998 The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA 2 domain protein. Plant Cell 10 1043 1054

36. BrewerPBDunEAFergusonBJRameauCBeveridgeCA 2009 Strigolactone acts downstream of auxin to regulate bud outgrowth in pea and Arabidopsis. Plant Physiol 150 482 493

37. ShibasakiKUemuraMTsurumiSRahmanA 2009 Auxin response in Arabidopsis under cold stress: underlying molecular mechanisms. Plant Cell 21 3823 3838

38. UlmasovTMurfettJHagenGGuilfoyleTJ 1997 Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9 1963 1971

39. MarchantAKargulJMaySTMullerPDelbarreA 1999 AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. Embo J 18 2066 2073

40. MullerAGuanCGalweilerLTanzlerPHuijserP 1998 AtPIN2 defines a locus of Arabidopsis for root gravitropism control. Embo J 17 6903 6911

41. GalweilerLGuanCMullerAWismanEMendgenK 1998 Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282 2226 2230

42. BennettMJMarchantAGreenHGMaySTWardSP 1996 Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273 948 950

43. SwarupRFrimlJMarchantALjungKSandbergG 2001 Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes Dev 15 2648 2653

44. ParryGDelbarreAMarchantASwarupRNapierR 2001 Novel auxin transport inhibitors phenocopy the auxin influx carrier mutation aux1. Plant J 25 399 406

45. UlmasovTHagenGGuilfoyleTJ 1999 Activation and repression of transcription by auxin-response factors. Proc Natl Acad Sci U S A 96 5844 5849

46. UlmasovTHagenGGuilfoyleTJ 1999 Dimerization and DNA binding of auxin response factors. Plant J 19 309 319

47. SchruffMCSpielmanMTiwariSAdamsSFenbyN 2006 The AUXIN RESPONSE FACTOR 2 gene of Arabidopsis links auxin signalling, cell division, and the size of seeds and other organs. Development 133 251 261

48. LehmanABlackREckerJR 1996 HOOKLESS1, an ethylene response gene, is required for differential cell elongation in the Arabidopsis hypocotyl. Cell 85 183 194

49. SunJXuYYeSJiangHChenQ 2009 Arabidopsis ASA1 is important for jasmonate-mediated regulation of auxin biosynthesis and transport during lateral root formation. Plant Cell 21 1495 1511

50. RoggLEBartelB 2001 Auxin signaling: derepression through regulated proteolysis. Dev Cell 1 595 604

51. VannesteSFrimlJ 2009 Auxin: a trigger for change in plant development. Cell 136 1005 1016

52. OkushimaYOvervoordePJArimaKAlonsoJMChanA 2005 Functional genomic analysis of the AUXIN RESPONSE FACTOR gene family members in Arabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19. Plant Cell 17 444 463

53. LiuPPMontgomeryTAFahlgrenNKasschauKDNonogakiH 2007 Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. Plant J 52 133 146

54. OkushimaYFukakiHOnodaMTheologisATasakaM 2007 ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. Plant Cell 19 118 130

55. WilliamsLCarlesCCOsmontKSFletcherJC 2005 A database analysis method identifies an endogenous trans-acting short-interfering RNA that targets the Arabidopsis ARF2, ARF3, and ARF4 genes. Proc Natl Acad Sci U S A 102 9703 9708

56. MarinEJouannetVHerzALokerseASWeijersD 2010 miR390, Arabidopsis TAS3 tasiRNAs, and their AUXIN RESPONSE FACTOR targets define an autoregulatory network quantitatively regulating lateral root growth. Plant Cell 22 1104 1117

57. GhassemianMNambaraECutlerSKawaideHKamiyaY 2000 Regulation of abscisic acid signaling by the ethylene response pathway in Arabidopsis. Plant Cell 12 1117 1126

58. BeaudoinNSerizetCGostiFGiraudatJ 2000 Interactions between abscisic acid and ethylene signaling cascades. Plant Cell 12 1103 1115

59. BradySMSarkarSFBonettaDMcCourtP 2003 The ABSCISIC ACID INSENSITIVE 3 (ABI3) gene is modulated by farnesylation and is involved in auxin signaling and lateral root development in Arabidopsis. Plant J 34 67 75

60. RockCDSunX 2005 Crosstalk between ABA and auxin signaling pathways in roots of Arabidopsis thaliana (L.) Heynh. Planta 222 98 106

61. Shkolnik-InbarDBar-ZviD 2010 ABI4 Mediates Abscisic Acid and Cytokinin Inhibition of Lateral Root Formation by Reducing Polar Auxin Transport in Arabidopsis. Plant Cell 22 3560 3573

62. SwarupRPerryPHagenbeekDVan Der StraetenDBeemsterGT 2007 Ethylene upregulates auxin biosynthesis in Arabidopsis seedlings to enhance inhibition of root cell elongation. Plant Cell 19 2186 2196

63. KlineKGBarrett-WiltGASussmanMR 2010 In planta changes in protein phosphorylation induced by the plant hormone abscisic acid. Proc Natl Acad Sci U S A 107 15986 15991

64. RashotteAMDeLongAMudayGK 2001 Genetic and chemical reductions in protein phosphatase activity alter auxin transport, gravity response, and lateral root growth. Plant Cell 13 1683 1697

65. PetrasekJFrimlJ 2009 Auxin transport routes in plant development. Development 136 2675 2688

66. TimpteCWilsonAKEstelleM 1994 The axr2-1 mutation of Arabidopsis thaliana is a gain-of-function mutation that disrupts an early step in auxin response. Genetics 138 1239 1249

67. WilsonAKPickettFBTurnerJCEstelleM 1990 A dominant mutation in Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol Gen Genet 222 377 383

68. RodriguezPLBenningGGrillE 1998 ABI2, a second protein phosphatase 2C involved in abscisic acid signal transduction in Arabidopsis. FEBS Lett 421 185 190

69. RenXChenZLiuYZhangHZhangM 2010 ABO3, a WRKY transcription factor, mediates plant responses to abscisic acid and drought tolerance in Arabidopsis. Plant J

70. ToriiKUMitsukawaNOosumiTMatsuuraYYokoyamaR 1996 The Arabidopsis ERECTA gene encodes a putative receptor protein kinase with extracellular leucine-rich repeats. Plant Cell 8 735 746

71. RomanGLubarskyBKieberJJRothenbergMEckerJR 1995 Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway. Genetics 139 1393 1409

72. XuJScheresB 2005 Dissection of Arabidopsis ADP-RIBOSYLATION FACTOR 1 function in epidermal cell polarity. Plant Cell 17 525 536

73. XiaRWangJLiuCWangYWangY 2006 ROR1/RPA2A, a putative replication protein A2, functions in epigenetic gene silencing and in regulation of meristem development in Arabidopsis. Plant Cell 18 85 103

Genetika Reprodukční medicína

Článek vyšel v časopise

PLOS Genetics

2011 Číslo 7

Nejčtenější v tomto čísle

Tomuto tématu se dále věnují…


Zvyšte si kvalifikaci online z pohodlí domova

Kurz originály vs. generika
nový kurz

Klinická farmakokinetika betablokátorů

Současné možnosti terapie osteoartrózy
Autoři: MUDr. Jakub Holešovský

Preferovaná úlevová léčba Asthma Bronchiale
Autoři: PharmDr. Petr Sedlák

Inhibitory karboanhydrázy v léčbě glaukomu
Autoři: MUDr. Petr Výborný, CSc., FEBO

Všechny kurzy
Zapomenuté heslo

Nemáte účet?  Registrujte se

Zapomenuté heslo

Zadejte e-mailovou adresu se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.


Nemáte účet?  Registrujte se