-
Články
Top novinky
Reklama- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
Top novinky
Reklama- Videa
- Podcasty
Nové podcasty
Reklama- Kariérní portál
Doporučené pozice
Reklama- Praxe
Top novinky
ReklamaHistone Crosstalk Directed by H2B Ubiquitination Is Required for Chromatin Boundary Integrity
Genomic maps of chromatin modifications have provided evidence for the partitioning of genomes into domains of distinct chromatin states, which assist coordinated gene regulation. The maintenance of chromatin domain integrity can require the setting of boundaries. The HS4 insulator element marks the 3′ boundary of a heterochromatin region located upstream of the chicken β-globin gene cluster. Here we show that HS4 recruits the E3 ligase RNF20/BRE1A to mediate H2B mono-ubiquitination (H2Bub1) at this insulator. Knockdown experiments show that RNF20 is required for H2Bub1 and processive H3K4 methylation. Depletion of RNF20 results in a collapse of the active histone modification signature at the HS4 chromatin boundary, where H2Bub1, H3K4 methylation, and hyperacetylation of H3, H4, and H2A.Z are rapidly lost. A remarkably similar set of events occurs at the HSA/HSB regulatory elements of the FOLR1 gene, which mark the 5′ boundary of the same heterochromatin region. We find that persistent H2Bub1 at the HSA/HSB and HS4 elements is required for chromatin boundary integrity. The loss of boundary function leads to the sequential spreading of H3K9me2, H3K9me3, and H4K20me3 over the entire 50 kb FOLR1 and β-globin region and silencing of FOLR1 expression. These findings show that the HSA/HSB and HS4 boundary elements direct a cascade of active histone modifications that defend the FOLR1 and β-globin gene loci from the pervasive encroachment of an adjacent heterochromatin domain. We propose that many gene loci employ H2Bub1-dependent boundaries to prevent heterochromatin spreading.
Published in the journal: . PLoS Genet 7(7): e32767. doi:10.1371/journal.pgen.1002175
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1002175Summary
Genomic maps of chromatin modifications have provided evidence for the partitioning of genomes into domains of distinct chromatin states, which assist coordinated gene regulation. The maintenance of chromatin domain integrity can require the setting of boundaries. The HS4 insulator element marks the 3′ boundary of a heterochromatin region located upstream of the chicken β-globin gene cluster. Here we show that HS4 recruits the E3 ligase RNF20/BRE1A to mediate H2B mono-ubiquitination (H2Bub1) at this insulator. Knockdown experiments show that RNF20 is required for H2Bub1 and processive H3K4 methylation. Depletion of RNF20 results in a collapse of the active histone modification signature at the HS4 chromatin boundary, where H2Bub1, H3K4 methylation, and hyperacetylation of H3, H4, and H2A.Z are rapidly lost. A remarkably similar set of events occurs at the HSA/HSB regulatory elements of the FOLR1 gene, which mark the 5′ boundary of the same heterochromatin region. We find that persistent H2Bub1 at the HSA/HSB and HS4 elements is required for chromatin boundary integrity. The loss of boundary function leads to the sequential spreading of H3K9me2, H3K9me3, and H4K20me3 over the entire 50 kb FOLR1 and β-globin region and silencing of FOLR1 expression. These findings show that the HSA/HSB and HS4 boundary elements direct a cascade of active histone modifications that defend the FOLR1 and β-globin gene loci from the pervasive encroachment of an adjacent heterochromatin domain. We propose that many gene loci employ H2Bub1-dependent boundaries to prevent heterochromatin spreading.
Introduction
There is growing consensus that the non-random chromosomal arrangement of genes in higher eukaryotes enables the sharing of specific chromatin environments that facilitate co-regulation.
Recent genomic profiling of histone modifications, chromatin factors and nuclear proximity in Drosophila and mammalian cells have revealed prevalent organization of genes into domains, or neighborhoods, of common chromatin state [1]–[5]. Genes taken out of their natural chromosomal environment become deregulated in a variety of human genetic diseases [6]. This so-called chromosomal position effect also underlies the variable expression of transgenes depending on their site of integration [7].
The maintenance of chromatin domain integrity can require the setting of boundaries. Boundaries not only allow the partitioning of gene regulation, but also may also maintain the concentration of factors required for heterochromatin structures and normal genome homeostasis [8]. Fixed chromatin boundaries can be established by DNA sequence elements called insulators, which function to protect genes from inappropriate signals emanating from their surrounding environment [9]–[12]. HS4 is a well characterized element that has served as a paradigm for the study of insulators in vertebrates. HS4 lies at a boundary between the chicken β-globin gene cluster and upstream region of condensed chromatin that is enriched in the epigenetic hallmarks of heterochromatin [13]–[15]. A 275 bp core of the HS4 element has two separable activities that functionally define insulators: it can block the action of an enhancer element on a linked promoter when positioned between the two and it can act as a barrier to chromosomal position effect silencing [16]–[18]. The enhancer blocking and barrier activities of HS4 involve different proteins and mechanisms and are separable in assay systems. The CTCF binding site footprint II (FII) is necessary and sufficient for enhancer blocking, but can be deleted from HS4 without affecting barrier activity [18]–[20]. HS4 requires a USF1/USF2 binding site (FIV) and three VEZF1 binding sites (FI, FIII and FV) for its barrier activity, which control histone modifications and DNA methylation, respectively [21]–[24].
HS4 manipulates histone modification signatures to counteract gene silencing [22], [24]. HS4 has been found to be persistently enriched in high levels of H3 and H4 acetylation, H3-lysine 4 methylation, H4-arginine 3 methylation and acetylated histone variant H2A.Z regardless of neighboring gene expression [13]–[14], [23], [25]. We proposed that the active histone modifications at HS4 collectively act as a chain terminator to heterochromatin assembly by interfering with the propagation of repressive histone modifications [24].
Given that chromosomal silencing has been shown to be processive and stable, we reasoned that the HS4 element needs to act as a constitutive barrier if it is to effectively shield the locus. In this study, we address a hypothesis that HS4 might recruit histone modifications that act as master controllers of the active chromatin state to facilitate barrier stability. Intense study in recent years has begun to unravel the complex language of crosstalk between histone modifications during the establishment of different chromatin states [26]. Principal among the active histone modifications is the monoubiquitination of H2BK120 (H2BK123 in S. cerevisiae), which is required for the tri-methylation of H3K4 [27]–[30]. H3K4me3 is a pivotal mark of the active chromatin state, by acting as a platform for the binding of multiple histone acetyltransferase, histone demethylase and nucleosome remodelling complexes [31]–[33]. We therefore investigate whether i) H2B ubiquitination directs a cascade of active histone modifications at the HS4 insulator, ii) this modification is required for its barrier activity, and iii) the integrity of the 3′ chromatin boundary of the condensed chromatin located upstream of the β-globin locus. We also extend our analysis to look at the 5′ chromatin boundary of the same condensed chromatin and its role in shielding the FOLR1 gene locus.
Results
Histone ubiquitination is a mark of chromatin boundaries
We sought to address whether histone H2B ubiquitination plays a key role in establishing and maintaining the boundaries of a condensed heterochromatin-like domain that separates the FOLR1 and β-globin gene loci. Firstly, we mapped the presence of ubiquitinated nucleosomes across 50 kb encompassing the chicken β-globin locus (Figure 1). We established native chromatin immunoprecipitation (N-ChIP) assays using nucleosomes prepared by micrococcal nuclease (MNase) digestion of chromatin in low salt conditions to ensure the retention of potentially unstable variant nucleosomes found at this locus [34]. We prepared di - and tri-nucleosomes using a range of MNase concentrations which ensured that they were representative of open and condensed chromosomal regions (Figure 1A, data not shown). The N-ChIP method strips away non-nucleosomal proteins (Figure 1B), which allows the analysis of ubiquitinated histones using anti-ubiquitin antibodies. The enrichment of nucleosomes containing the 25 kDa monoubiquitinated form of H2B was confirmed by western blotting (Figure 1C).
Fig. 1. The HS4 insulator is enriched with ubiquitinated histones.
A) Sucrose gradient fractionation of native MNase-digested nucleosomes. Fractions containing di- and tri- nucleosomes (e.g., 5–7) are pooled for ChIP analysis. B) SDS-PAGE analysis of histone purity in di/tri-nucleosome preparations from 10 day chick embryo red cells (R) and whole brain (B). C) Western blot analysis of mono-ubiquitinated H2B present in immunoprecipitates from 6C2 cell di/tri-nucleosomes. D, E) Native ChIP of histone ubiquitination at sites across the chicken β-globin gene neighborhood in 10 day chick embryo red cells (D) and whole brain (E). The enrichment of each sequence is normalized to the background observed at the downstream inactive OR51M1 (COR3′) gene. Significant ChIP enrichments are represented by asterisks (☆ = p<0.01, ☆☆ = p<0.001 and ☆☆☆ = p<0.0001). F) Scale map of the chicken β-globin gene neighborhood. The exons of the FOLR1, β-globin (ρ, βH, βA and ε) and OR51M1 genes are depicted by purple, red and green boxes, respectively. Grey boxes represent CR1 repeat sequences. Light blue boxes indicate ERV1 sequences. Vertical arrows show early/late erythroid (purple/red) or constitutive (blue) DNaseI hypersensitive regulatory elements. G) The USF site is required for histone ubiquitination at transgenic HS4 insulators stably integrated into 6C2 cells. Native ChIP enrichments normalized to the endogenous HS4 element. N-ChIP analysis of histone ubiquitination was performed on primary red blood cells (RBC) from 10 day chick embryos, in which the β-globin locus is highly transcriptionally active, but the 5′ folate receptor (FOLR1) locus is silent [15], [35]. We observe a striking enrichment of ubiquitinated histones specifically at the core HS4 insulator element (Figure 1D; p-value from student's t-test of enrichment = 2e−6). Perhaps surprisingly, no enrichment of histone ubiquitination was observed at the promoters or enhancers of the highly active β-globin genes in RBCs. We also mapped histone ubiquitination in 10 day embryo whole brain tissue (Figure 1E), where both the FOLR1 and β-globin genes are reported to be silent [15]. We also observe a specific enrichment of ubiquitinated histones specifically at the core HS4 insulator element in brain tissues (Figure 1E, p-value = 6e−5). We also observe significant levels of histone ubiquitination at the FOLR1 gene regulatory elements HSA and HSB in both 10 day embryo RBCs (Figure 1D, p-value = 0.007) and whole brain (Figure 1E, p-value = 2e−5). These elements are situated between the FOLR1 gene and the condensed region and may harbor chromatin boundary activity.
We sought to determine which of the well characterized activities of the 275 bp core HS4 element are required for the recruitment of histone ubiquitination. We performed N-ChIP analyses of histone ubiquitination at HS4 insulators present on single copy transgenes stably integrated into the early erythroid CFU-E stage cell line 6C2 [18]. We find that transgenic HS4 insulators are enriched in histone ubiquitination at a level equivalent to the endogenous HS4 element (WT, Figure 1G). Histone ubiquitination is therefore likely to be recruited by one of the factors that mediate the insulator functions of the core HS4 element. We performed N-ChIP analysis of single copy transgenic HS4 elements that are mutated at the CTCF (FII), VEZF1 (FIII) or USF1 (FIV) binding sites. These mutations have been extensively characterized and disrupt HS4's ability to mediate enhancer blocking, protection from DNA methylation or active histone modification, respectively [19], [21], [24]. We find that the USF1/USF2 binding site, footprint IV, is required for the recruitment of histone ubiquitination (Figure 1G). This correlates with our previous finding that the USF site was also required for H3K4 methylation of the HS4 insulator [24].
RNF20 is required for H2B ubiquitination and trans histone crosstalk
The histone ubiquitination that is enriched at the HS4 element may occur on any of the core histones. We anticipated that histone H2B is subject to this modification as HS4 is constantly enriched in methylated H3K4 [13], [24], and H2BK120 mono-ubiquitination is required for proper H3K4 methylation [27]–[30]. Using crosslinking ChIP with recently developed antibodies, we confirmed that the core HS4 insulator was enriched in H2BK120ub1 in the early erythroid CFU-E stage cell line 6C2 (Figure 2A). We were unable to detect any enrichment of H2AK119ub1 at HS4 or other β-globin sequences (not shown).
Fig. 2. The ubiquitin ligase RNF20 mediates H2B ubiquitination at the HS4 insulator.
Crosslinking ChIP analysis of (A) H2BK120ub1 and (B) RNF20 enrichment at the chicken β-globin locus in 6C2 cells. The enrichment of each sequence is normalized to the background observed at the condensed region (15.850). C–E) Analyses of early erythroid 6C2 cells following four days of doxycycline-induced knockdown of RNF20 expression. (C) Western blotting of whole cell extracts with (+) and without (−) doxycycline-induced RNF20 knockdown. The expression levels of each factor (relative to the loading control TBP) after RNF20 knockdown are shown. (D) Western blotting of histone modifications present on total nucleosomes with and without RNF20 knockdown. The levels of each modification after RNF20 knockdown (relative to unmodified H3 loading control) are shown. (E) Native ChIP of histone ubiquitination at sites across the chicken β-globin gene neighborhood in wild type (red bars) and RNF20 knockdown (blue bars) 6C2 cells. The enrichment of each sequence is normalized to the background observed downstream of the inactive ρ-globin gene. Significant changes in ChIP enrichments following RNF20 depletion are represented by asterisks (☆ = p<0.01, ☆☆ = p<0.001 and ☆☆☆ = p<0.0001). We sought to identify the E3 ligase responsible for H2Bub1 at the HS4 element so that the effects of depleting H2Bub1 could be studied. We used crosslinking ChIP analysis to show that RNF20 interacts with the core HS4 insulator element in erythroid cells (Figure 2B). Chicken RNF20 (BRE1A), is 90% identical to human RNF20/BRE1A, which is an E3 ligase responsible for efficient H2B ubiquitination (Figure S1A) [36]–[37]. The presence of RNF20 therefore suggests that this enzyme is required for the enrichment of H2BK120ub1 at the HS4 insulator.
Next, we investigated whether H2Bub1 levels can be depleted following RNAi of RNF20. It was important that we were able to knockdown RNF20 levels for prolonged periods as this would allow the study of progressive repression of the β-globin locus and insulated transgenes. This was achieved in 6C2 cells using a lentiviral vector system for doxycycline-regulated expression of miRNA-shRNA (Materials and methods, Figure S1). After four days of shRNA expression, RNF20 protein levels were reduced to ∼20% of wild type (Figure 2C). We saw little change in the whole cell protein levels of the HS4-binding proteins CTCF, VEZF1 or USF1. We studied the effect of this short term knockdown of RNF20 expression on a panel of histone modifications in total chromatin. We found that H2BK120ub1 levels in chromatin were reduced by ∼80% (Figure 2D). RNF20 knockdown did not affect H2AK119ub1 levels. This confirmed that chicken RNF20 is a H2B-specific ubiquitin E3 ligase like its Bre1 orthologs. The reduction of H2B ubiquitination resulted in substantial reductions in H3K4me3 (70%) and H3K79me2 (53%) levels, and a minor reduction in H3K4me2 (20%) (Figure 2D). This demonstrates that chickens also employ the same trans-histone crosstalk pathways observed in yeast and mammals [26]. H3K9acK14ac was slightly reduced (7%), but the levels of other modifications associated with active or repressive chromatin remained largely unchanged (Figure 2D).
To determine whether RNF20 was responsible for all the histone ubiquitination observed at the HS4 and FOLR1 elements, we performed N-ChIP analysis across the FOLR1 and β-globin region before and after RNF20 knockdown in 6C2 cells. Consistent with our observations in primary 10 day embryo tissues, we find that the HS4 insulator and the FOLR1 HSA/HSB elements are substantially enriched in histone ubiquitination in 6C2 cells (Figure 2E). In addition, there is elevated histone ubiquitination across the FOLR1 gene, which is highly active in 6C2 cells, consistent with co-transcriptional deposition (Figure 2E). We observed a substantial depletion of histone ubiquitination at the HS4 insulator and FOLR1 HSA/HSB elements following four days of RNF20 knockdown (Figure 2E; p-values from student's t-test of difference between WT and RNF20kd are 2e−5 and 0.002, respectively). We observe similar profiles of RNF20-dependent H2Bub1 in 6C2 cells (Figure S2). The histone ubiquitination observed at HS4 and the FOLR1 regulatory elements is therefore RNF20-dependent H2B monoubiquitination.
Loss of H2B ubiquitination results in a collapse of the active chromatin signatures at the FOLR1 and β-globin chromatin boundaries
The HS4 insulator is marked by an assemblage of histone modifications and variants typically associated with transcriptionally permissive open chromatin; H3K9acK14ac, H4K5acK8acK12acK16ac, H3K4me2, H3K4me3, H4R3me2as, H2A.ZK4acK7acK11ac, and H2BK120ub1 [13]–[14], [23] and this study). This active modification signature is a constant feature of HS4 in a variety of cell types irrespective of local gene expression. A very similar chromatin signature is observed at the FOLR1 HSA/HSB regulatory elements in 6C2 cells. We hypothesize that H2Bub1 may be the keystone for the deposition of the active histone signature at these elements. We therefore performed N-ChIP analysis of active and repressive modifications across the 50 kb β-globin gene neighborhood following short term knockdown of H2B ubiquitination.
We found that H3K4me2 and H3K4me3 enrichments at the HS4 insulator element were reduced by 40% and 70%, respectively, following RNF20 knockdown (21.540, Figure 3A and 3B). This is consistent with trans H2Bub1-H3K4me3 cross-talk occurring at HS4 nucleosomes. The depletion of H3K4me at HS4 is specific as the levels observed at the active FOLR1 gene promoter remain unchanged (5.613, Figure 3A and 3B). Strikingly, the loss of H2Bub1 also considerably impacts the hyperacetylation of multiple histones at the HS4 insulator, with H3ac, H4ac and H2A.Zac reduced by 55%, 60% and 70%, respectively (21.540, Figure 3C, 3D and 3F). The depletion of histone acetylation at the HS4 insulator is in contrast to the relatively unchanged levels of histone acetylation in bulk chromatin (Figure 2D). We note that very similar depletions in active modifications are also observed at the FOLR1 gene regulatory elements HSA/HSB. These regulatory elements may harbor functional properties similar to those of the HS4 insulator element. H2A.Z incorporation was mostly unaffected, but there was a 50% reduction in H2A.Z levels specifically at the core of the HS4 insulator (21.540, Figure 3E).
Fig. 3. Loss of H2B ubiquitination results in a rapid loss of active histone modifications at the HS4 insulator.
Native ChIP analyses of early erythroid 6C2 cells following four days of doxycycline-induced knockdown of RNF20 expression. Enrichments of A) H3K4me2, B) H3K4me3, C) H3K9acK14ac, D) H4K5acK8acK12acK16ac, E) H2A.Z, F) H2A.ZK4acK7acK11ac, G) H3K9me2 and H) H3K9me3 at sites across the chicken β-globin gene neighborhood in wild type (red bars) and RNF20 knockdown (blue bars) cells. The enrichment of each sequence is normalized to the background observed downstream of the inactive ρ-globin gene (34.715). Significant changes in ChIP enrichments following RNF20 depletion are represented by asterisks (☆ = p<0.05, ☆☆ = p<0.01 and ☆☆☆ = p<0.005). The location of the core HS4 insulator (site 21.540) is highlighted in red. Sites within the condensed region are indicated in panels G and H. We investigated whether the depletion of H2Bub1 and the resulting loss of the active histone signatures at the HSA/HSB and HS4 elements affected the containment of the intervening condensed region. We determined that H3K9me2 and H3K9me3 are restricted to the condensed region upstream of HS4 in wild type 6C2 cells (8.9 to 17.7, Figure 3G and 3H, not shown). We find that after only four days of H2Bub1 depletion there is marked encroachment of H3K9me2 beyond the HS4 insulator. Significant H3K9me2 spreading into the β-globin locus is observed at all sites from the condensed region to the ρ-globin gene promoter (Figure 3G). Significant H3K9me2 spreading is also observed in the other direction, encompassing the FOLR1 promoter and gene body. No encroachment of H3K9me3 is observed after short term depletion of H2Bub1, but there is considerable consolidation of this mark at the edges of the condensed region (Figure 3H). The heterochromatin associated mark H4K20me3 is also enriched in the condensed region and at the 3′ end of the FOLR1 gene, but did not spread upon four days of RNF20 knockdown (Figure S3). Finally, we found that the gene silencing mark H3K27me3 was present at comparably low levels across the condensed region and β-globin locus in 6C2 cells, which did not alter upon RNF20 knockdown (data not shown). In summary, short term depletion of H2Bub1 is sufficient to disrupt H3K4me3 at the HSA/HSB and HS4 elements, which results in a rapid loss of multiple histone acetylation and chromatin boundary integrity. H3K9me2 appears as the first repressive mark to spread beyond the defective boundaries of the condensed heterochromatin region.
Insulator protein complexes remain intact despite chromatin boundary failure
The comprehensive loss of active histone modifications at the HS4 boundary following RNF20 knockdown may be due to reduced binding of the insulator proteins that recruit histone modifying enzymes. We showed above that the expression of the insulator proteins is unaffected following RNF20 knockdown (Figure 2C). We therefore determined the binding of the insulator factors USF1, CTCF and VEZF1 to HS4 using crosslinking ChIP analysis before and after the loss of active modifications following RNF20 knockdown. We find that the binding of each factor is unaffected following RNF20 knockdown (Figure 4A–4C). We also discovered that the heterochromatin barrier factors VEZF1 and USF1 are also stably bound at the FOLR1 HSA and HSB elements, which contain binding motifs for both factors (Figure 4B and 4C). The FOLR1 region is not bound by the enhancer blocking and chromatin looping factor CTCF (Figure 4A). In summary, the disruption of insulator protein binding is not responsible for the comprehensive loss of active histone modifications at the HSA/HSB and HS4 elements.
Fig. 4. Loss of H2B ubiquitination does not disrupt the binding of insulator protein complexes at HS4.
Crosslinking ChIP analysis of A) CTCF, B) VEZF1, C) USF1 and D) RBBP5 occupancy at the chicken FOLR1/β-globin loci in 6C2 cells before (red) and after (blue bars) the induction of RNF20 knockdown. We also addressed whether the depletion of H2Bub1 prevented the stable recruitment of histone methyltransferase (HMT) complexes that target H3-lysine 4. Existing models used to explain trans-tail crosstalk between H2Bub1 and H3K4me3 propose that the ubiquitination of H2B either regulates HMT residence by controlling nucleosome stability or creates a binding interface for HMT binding to chromatin (see discussion). We performed crosslinking ChIP analysis for RBBP5, a structural component of the SET1/COMPASS complex that interacts with USF1 [22]. We find that RBBP5 interacts with the HS4 insulator and the FOLR1 regulatory elements, all of which are sites of H3K4me3. The binding of RBBP5 to the HS4 or HSA/HSB boundary elements is not significantly affected by RNF20 knockdown (Figure 4D). The loss of H3K4me3 upon H2Bub1 depletion is therefore not due to the decreased residence of the core SET1 complex at HS4.
H2B ubiquitination is required for chromatin barrier activity
The ability of the HS4 element to shield genes from chromosomal position effect silencing in a wide variety of systems is well established [38]. This so-called barrier activity can be scored using a well established reporter transgene assay in erythroid cells [17]–[18], [24]. We used this assay to monitor the expression of a human IL-2R fragment from stably integrated transgenes (Figure 5A) using flow cytometry over time in culture. Non-insulated transgenes typically succumb to chromosomal silencing by 40–60 days of culture, whereas transgenes insulated by HS4 elements are able to maintain original levels of expression for 80 days and beyond [18]. We took extensively characterized stable lines that each contain a single copy of the IL-2R transgene flanked by paired 275 bp core HS4 insulators. It was previously determined that transgene expression from these cells remains constant beyond 80 days of culture, the transgenic HS4 insulators are bound by CTCF, USF1 and VEZF1 [21], and they are enriched in H3ac, H4ac, H3K4me [18], [24] and H2Bub1 (Figure 1G).
Fig. 5. H2B ubiquitination is required for HS4 barrier activity.
A) Schematic representation of the IL-2R reporter transgene flanked by double copy HS4 insulators. B–E) FACS analyses of IL-2R expression in two independent RNF20 knockdown lines over time in culture. B, D) Mean fluorescence intensity of IL-2R expression in two independently derived RNF20 knockdown lines (blue bars), relative to wild type parental cells (red bars). C, E) IL-2R fluorescence in the cell lines shown in panels (B) and (D) after 80 and 60 days of RNF20 knockdown, respectively, overlaid with that of parental wild type (WT) cells. We transduced early passage IL-2R transgenic cells with lentiviruses that express RNF20 shRNA. The lentiviral miRNA-shRNA system we employed allowed the stable knockdown of RNF20 for at least sixty days (validated by Western blotting). We observed no change in 6C2 cell morphology and only a minimal reduction in cell doubling during this period (not shown). We found that four days of RNF20 knockdown had no effect on transgene expression (day 4, Figure 5B, 5D). The depletion of H2Bub1 therefore has little direct effect on the transcription rate of the transgene. However, transgene expression became progressively silenced with continued depletion of H2Bub1, with the IL-2R expression levels in independent transgenic lines falling by 50–60% after long term depletion (Figure 5B, 5D). This level of silencing is less than that observed when flanking insulators are absent or mutated [18], but is comparable to that observed in cells transfected with AUSF, a truncated form of USF1 that dominantly inhibits USF1 function [22]. Thus, constant H2B ubiquitination is required for HS4 to act as a stable barrier to chromosomal silencing.
Loss of boundary function leads to comprehensive spreading of repressive chromatin
It has been postulated that the HSA/HSB regulatory region and the HS4 insulator might form chromatin boundaries that protect the FOLR1 and β-globin genes from the encroachment of the potentially repressive condensed chromatin that separates these loci [15], [24]. We have therefore studied how long term depletion of H2Bub1 impacts on the containment of heterochromatin associated marks at these loci. We maintained the induction of RNF20 knockdown for forty days, which reduced proteins levels to 9% of wild type, compared to 19% seen after four days of knockdown (Figure 6A, Figure 2C). The prolonged RNF20 knockdown resulted in the depletion of H2BK120ub1 in total chromatin to 13% of wild type levels (Figure 6B). This in turn, resulted in considerable reductions in total H3K4me2 and H3K4me3, reduced by 78% and 77%, respectively (Figure 6B). Conversely, we observe 43% and 39% increases in the heterochromatin marks H3K9me3 and H4K20me3 in total chromatin (Figure 6B). This is in clear contrast to the unchanged levels of heterochromatin marks after short term knockdown (Figure 2D). Interestingly, the incorporation of the variant histone H2A.Z in total chromatin also increased by 24% after prolonged RNF20 depletion, perhaps to compensate for the gross shift from active to repressive chromatin across the genome (Figure 6B).
Fig. 6. Long term loss of H2B ubiquitination results in a breach of the HS4 chromatin boundary.
Analyses of early erythroid 6C2 cells following forty days of doxycycline-induced knockdown of RNF20 expression. A) Western blotting of whole cell extracts with (+) and without (−) doxycycline-induced RNF20 knockdown. The expression level of RNF20 following knockdown (relative to the loading control TBP) is shown. B) Western blotting of histone modifications present on total nucleosomes with and without RNF20 knockdown. The levels of each modification after RNF20 knockdown (relative to unmodified H3) are shown. C–G) Native ChIP analyses following forty days of RNF20 knockdown. Enrichments of C) H2BK120ub1, D) H3K4me2, E) H3K4me3, F) H3K9me3 and G) H4K20me3 at sites across the chicken β-globin gene neighborhood in wild type (red bars) and RNF20 knockdown (blue bars) cells. The enrichment of each sequence is normalized to the background observed at the condensed region (15.850). Significant changes in ChIP enrichments following RNF20 depletion are represented by asterisks (☆ = p<0.05, ☆☆ = p<0.01 and ☆☆☆ = p<0.005). The location of the core HS4 insulator (21.540) is highlighted in red. We performed N-ChIP analyses of histone modifications across the FOLR1 and β-globin loci to determine the effects of long term RNF20 knockdown on chromatin domain integrity. Firstly, we confirmed that H2BK120ub1 was depleted from the HS4 insulator (Figure 6C). The levels of H3K4me2 and H3K4me3 at HS4 were greatly depleted (by 80% and 65%, respectively) as a result of the long term depletion of H2BK120ub1 (Figure 6D, 6E). The loss of active modifications at HS4 for a prolonged period results in extensive encroachment of the heterochromatin associated marks H3K9me3 and H4K20me3, which are normally restricted to the condensed region between the FOLR1 and β-globin loci. Strikingly, H3K9me3 spreads beyond HS4 to encompass the entire 33 kb β-globin locus (Figure 6F). H3K9me3 spreading is likely to have occurred in the majority of cells in the population as the enrichment levels over the β-globin locus are comparable to those in the upstream condensed region. H3K9me3 spreading is also observed in the opposite direction, with significant increases in this mark over the FOLR1 promoter and gene body (Figure 6F). Furthermore, H4K20me3 is also observed to spread from the upstream condensed region to cover the FOLR1 gene in one direction and as far as the ρ-globin promoter in the other (Figure 6G).
Loss of boundary function results in FOLR1 gene silencing
H3K9me2, H3K9me3 and H4K20me3 are widely associated with gene silencing and heterochromatin formation. The encroachment of these marks over the FOLR1 and β-globin genes following RNF20 depletion may result in the silencing of their transcription. While the β-globin locus is becoming primed for expression at the CFU-E progenitor stage represented by 6C2 cells, the β-globin genes themselves are not expressed until terminal differentiation [15], [35]. 6C2 cells cannot be induced to terminally differentiate, so we are unable to study the impact of heterochromatin spreading on the activation of β-globin gene transcription in this system. We therefore focused our attention on the expression of the FOLR1 gene, which is active in 6C2 cells [15]. RT-PCR analysis shows that FOLR1 expression is not affected by four days of RNF20 knockdown (Figure 7). This is despite the depletion of H2Bub1, H3K4me2/3, H3ac, H4ac, H2A.Zac at the HSA/HSB regulatory region (Figure 3A–3D, 3F) and the encroachment of H3K9me2 across the FOLR1 promoter and gene body (Figure 3G). Closer inspection shows that H3K4me2/3 and H4ac of the FOLR1 promoter are unaffected following short term RNF20 depletion. FOLR1 gene transcription is therefore not directly dependent upon RNF20 or on maximal active histone modifications at the HSA/HSB elements. However, we find that FOLR1 gene transcription is progressively silenced with prolonged RNF20 knockdown, with 94% repression observed after sixty days of knockdown (Figure 7). The silencing of FOLR1 coincides with both the loss of H3K4me2/3 at its promoter (Figure 6D and 6E) and the accumulation of H3K9me3 and H4K20me3 over its promoter and gene body upon heterochromatin spreading (Figure 6F and 6G).
Fig. 7. FOLR1 expression is silenced following prolonged RNF20 depletion.
Transcript levels of RNF20 and FOLR1 in 6C2 cells following either 4, 30 or 60 days of doxycycline-induced RNF20 knockdown. Transcript levels are normalized to β-actin (ACTB) and are shown relative to wild type 6C2 cells treated with doxycycline. Significant changes in mRNA levels in knockdown cells are represented by asterisks (☆ = p<0.05, ☆☆ = p<0.01 and ☆☆☆ = p<0.005). Taken together, these findings demonstrate that the elements HSA/HSB and HS4 form the boundaries of the condensed chromatin region between the FOLR1 and β-globin gene loci. They employ an H2Bub-dependent active chromatin signature that protects these genes from the encroachment of multiple heterochromatin associated marks. The spreading of H3K9me3 and H4K20me3 coincides with the silencing of the FOLR1 gene.
Discussion
Similar histone signatures at the FOLR1 and β-globin loci heterochromatin boundaries
The first high resolution maps of histone modifications across gene loci during vertebrate development revealed that the well characterized chromatin boundary marked by the HS4 insulator is constitutively enriched with histone modifications associated with open chromatin [13]–[14]. Here we show that the HS4 insulator is also constitutively marked by H2BK120 mono-ubiquitination. We show that RNF20-dependent H2Bub1 is required not only for H3K4me2/3 at HS4, but also for multiple acetylation of H3, H4 and H2A.Z at this element (Figure 8A). A very similar H2Bub1-dependent active histone signature is also found at the HSA/HSB elements upstream of the FOLR1 gene. To our knowledge, this is the first example of H2Bub1 directing such an extensive cascade of trans histone tail modifications at specific gene regulatory elements.
Fig. 8. H2B ubiquitination in the establishment of a chromatin boundary.
A) HS4 lies at the boundary between the β-globin locus and an upstream region of condensed chromatin enriched in multiple repressive histone marks (blue). H2B ubiquitination at the HS4 insulator is mediated by the E3 ligase RNF20 and is dependent upon the USF binding site. H2Bub1 is required for H3K4me3 mediated by the SET1 complex and multiple histone acetylation at two or three nucleosomes around HS4 (green). B) Scale schematic diagram summarizing the extent of chromatin domains at the FOLR1 and β-globin loci mapped in wild type 6C2 cells (top panel) and cells following short-term (middle panel) and long-term (bottom panel) depletion of RNF20. Sequences enriched with H3K4me3, H4K20me3, H3K9me3 and H3K9me2 are represented by green, purple, dark blue and light blue rectangles, respectively. Faded green depicts the depletion of H3K4me3 at the boundary elements following RNF20 knockdown. Arrowheads depict the encroachment of heterochromatin marks. HSA/HSB and HS4 mark the 5′ and 3′ flanks of the condensed chromatin region between the FOLR1 and β-globin loci, which is enriched in the epigenetic hallmarks of heterochromatin ([13]–[15], this study) (Figure 8B). The loss of the active histone modification signature at these elements following the depletion of H2Bub1 in erythroid cells results in the progressive spreading of multiple repressive histone marks across the entire FOLR1 and β-globin loci. These findings clearly demonstrate that the elements HSA/HSB and HS4 form the boundaries of the condensed chromatin region between the FOLR1 and β-globin gene loci. The ability of the HS4 insulator to shield transgenes from chromosomal silencing in a wide variety of systems is well established [38], but this study provides firm evidence that HS4 functions as a chromatin boundary element in its endogenous context. Both the endogenous and transgenic HS4 elements require continued deposition of H2Bub1 to maintain chromatin boundary integrity and chromosomal position effect protection, respectively.
It has been unclear for some years how the FOLR1 gene locus is defended from heterochromatin spreading. An earlier study demonstrated that a 3.7 kb region that encompasses the FOLR1 promoter and upstream regulatory elements is capable of directing strong copy number-dependent expression of randomly integrated transgenes in chicken erythroid cells [15]. This fragment contains the major promoter-proximal element HSA and an additional DHS, which we have named HSB (Figure 1F). The elements may harbor locus control region (LCR)-like enhancer and/or chromatin boundary activities. Our observations are consistent with the latter. We find that the HSA and HSB elements are bound by the HS4 barrier proteins USF1 and VEZF1, they recruit RNF20 and the SET1 complex and establish an H2B-dependent active histone modification signature. These molecular features mirror those at the HS4 element. A key different between the HSA/HSB and HS4 boundary elements is the absence of CTCF binding at the FOLR1 boundary. This indicates that CTCF is not required to act a barrier to the spreading of heterochromatin from the condensed region. This is consistent with our previous findings that the CTCF binding site of the HS4 insulator is dispensable for its ability to act as a barrier to chromosomal silencing in different assay contexts [18], [20].
The modification of histones at chromatin boundaries is conserved across eukaryotes. It is well established that several histone acetyltransferases (HATs) are required for heterochromatin boundary integrity in budding yeast [10], [39]–[40]. Indeed, artificial tethering of HAT chimeras is sufficient to create synthetic barriers to heterochromatin-mediated gene silencing [41]. It has also recently been found that the ILB barrier element at the Drosophila reaper locus also recruits histone acetylation [42]. Our observations that the depletion of multiple histone acetylation marks results in chromatin boundary failure at the chicken FOLR1 and β-globin loci adds further support for a conserved role for active histone modification in chromatin boundary formation. The finding that multiple active histone modifications at the HSA/HSB and HS4 elements are directly or indirectly dependent upon prior H2B ubiquitination is particularly striking. Given the conservation of the factors that mediate H2B ubiquitination and the trans-histone H2Bub1-H3K4me3 pathway, we anticipate that this modification will be employed at boundaries across eukaryotes. The finding that artificial tethering of Lge1, a factor required for H2B ubiquitination and H3K4/K79 methylation, is sufficient to create a synthetic barrier to heterochromatin-mediated gene silencing in budding yeast supports this view [41], [43].
A number of budding yeast boundary elements are also associated with regions of nucleosome depletion and elevated histone turnover [40], [44]–[45]. This may be related to the incorporation of the histone variant H2A.Z, which supports heterochromatin boundary integrity [10], [46]. However, we did not observe any extensive depletion in histone density at the chicken HSA/HSB or HS4 chromatin boundaries (not shown). Furthermore, we found that the incorporation of H2A.Z at these boundaries remains intact following RNF20 knockdown and the loss of active modifications. Further studies are required to determine the role of H2A.Z at these elements, but it is clear that H2A.Z incorporation is not sufficient to prevent the spread of heterochromatin into the FOLR1 and β-globin loci.
Histone crosstalk and chromatin boundary formation
We have shown that the trans histone modification pathway from H2Bub1 to H3K4me3 reported in yeast and man is also conserved in chicken. How the mono-ubiquitination of H2B facilitates H3K4me3 has been subject to intense study over the last few years. Three models have arisen to explain this pathway. The ‘wedge’ model postulated that the bulky ubiquitin moiety would increase the access of H3K4 methyltransferases by non-specifically disrupting chromatin fiber packing in some way [47]–[48]. This simple mechanism appears improbable as substitution of ubiquitin with the bulkier SUMO moiety at the equivalent residue of H2B does not recapitulate H2Bub1-directed trans tail crosstalk in S. cerevisiae [49]. In contrast, a ‘stability’ model was recently put forward in response to findings in S. cerevisiae that H2Bub1 promotes nucleosome reassembly following RNA polymerase II transcription and enhances global nucleosome stability [49]–[51]. It is proposed that H2Bub1 may restrict the eviction of the H2A/H2B dimer from nucleosomes, thereby increasing the nucleosomal residence of the SET1/COMPASS methyltransferase complex which interacts with basic and acidic patches on H2A and H2B, respectively [52]–[53]. In this study, we found that the interaction of RBBP5 (SWD1), a core component of the SET1 complex remains bound at the HS4 insulator following the depletion of H2Bub1. The loss of H3K4me2/3 cannot be explained by the decreased residence of SET1 complexes.
Recent studies provide compelling evidence that H2Bub1 acts as ‘bridge’ to facilitate H3K4me3. The core SET1 complex can interact with chromatin and mediate H3K4 mono-methylation in the absence of H2B ubiquitination [54]. However, it has been found that the accessory COMPASS subunit Cps35/Swd2 in yeast (WDR82 in humans) interacts with H2Bub1 and activates the processive H3K4 methyltransferase activity of the SET1 complex [55]–[56]. While the composition of SET1 complexes in chickens remains to be determined, our data are consistent with a mechanism of H2Bub1-directed activation of pre-loaded SET1 complexes to facilitate processive H3K4 methylation. The loss of H3K4me2/3 upon the depletion of H2Bub1 is likely to be the primary reason for the subsequent losses of multiple histone acetylation at the HS4 insulator. Methylated H3K4 is a pivotal recognition site required by multiple histone acetyltransferase complexes [57]–[60]. H3K4me3 also facilitates the recruitment of the NURF chromatin remodelling complex via its BPTF subunit [22], [61].
Trans factor-directed H2B ubiquitination at chromatin boundaries
The mono-ubiquitination of H2B is broadly recognized as a mark of transcriptional activity [30]. H2Bub1 is enriched in the bodies of expressed genes throughout yeast and mammalian genomes [62]–[63], and the bulk of H2Bub1 requires many factors involved in the early steps of transcription elongation [30]. While the HS4 insulator has the epigenetic chromatin signature of a housekeeping promoter, it lacks either promoter or enhancer activity [64]. In addition, HS4 is not bound by RNA polymerase II (Figure S4) and is not a source of transcripts [22], [65]. It therefore appears most likely that HS4 recruits H2Bub1 through a process that is not linked to transcription. We found that the recruitment of H2Bub1 to HS4 is dependent upon the USF1/USF2 binding site. While we have been unable to detect RNF20 in stable complexes with USF1 or USF2 (data not shown) [22], this is reminiscent of activator-dependent recruitment of Bre1/RNF20 to yeast and human promoters [66].
In addition to the recruitment of the E3 ubiquitin ligase RNF20, the HSA/HSB and HS4 boundary elements also require sufficient activity levels of the E2 conjugase RAD6 to enable sufficient levels of H2Bub1 for chromatin boundary stability. There are two broad mechanisms that could result in the persistent H2B ubiquitination of the HS4 insulator. Firstly, the HSA/HSB and HS4 elements might not be subject to the rapid turnover of H2Bub1 associated with promoter clearance and transcription elongation [66]–[67]. Such a scenario would negate the need for the co-transcriptional stimulation of RAD6 conjugase activity [68], as low efficiency H2B ubiquitination may be sufficient for high steady state levels of H2Bub1 at HS4. Alternatively, HS4 may recruit factors that mediate RAD6 phosphorylation in the absence of RNA polymerase to stimulate efficient H2B ubiquitination of this element.
Heterochromatin spreading beyond defective boundaries
Depletion of H2Bub1 disrupts the assembly of the active histone modification signatures at the HSA/HSB and HS4 boundary elements. This results in progressive spreading of heterochromatin-associated histone marks into the FOLR1 and β-globin loci either side of the condensed region. We find that the heterochromatin-associated marks H3K9me2, H3K9me3 and H4K20me3 are propagated in a continuous manner from the upstream condensed region into the FOLR1 and β-globin loci. The heterochromatin domain expands from a ∼10 kb domain of the condensed region to cover the entire ∼50 kb FOLR1 and β-globin region given time (Figure 8B).
Intriguingly, each of the three repressive marks at the β-globin locus spreads in a different temporal manner, suggesting that different enzyme complexes are involved in propagating these marks. The first repressive mark to spread is H3K9me2, which propagates over the entire FOLR1 locus and extends 14 kb into the β-globin locus after only four days of H2Bub1 depletion (Figure 8B). Conversely, H3K9me3 and H4K20me3 do not extend beyond the upstream condensed region at this early stage, but H3K9me3 appears to consolidate at the borders of the condensed region. However, both H3K9me3 and H4K20me3 spread into the FOLR1 and β-globin loci upon longer periods of H2Bub1 depletion. H3K9me3 uniformly spreads to encompass the entire ∼50 kb FOLR1 and β-globin region, while H4K20me3 spreads into a ∼ 30 kb region covering the entire FOLR1 locus to the rho gene promoter (Figure 8B).
Several mechanisms have been proposed to explain the spreading of repressive chromatin [69]. Given that the de novo repressive marks in the FOLR1 and β-globin loci manifest as continuous domains with consistent modification levels throughout, we speculate that the marks are propagated via linear cis-spreading mechanisms. The simplest way to rationalize all our findings is that the spreading occurs using a classical stepwise assembly mechanism, where sequential iterations of repressor protein binding and methyltransferase recruitment propagate the repressive methyl mark onto neighboring nucleosomes. The ability of HP1 adaptor proteins to recognize H3K9me3, interact with H3K9 and H4K20 methyltransferases and spread from sites of recruitment is a potential example of the self-reinforcing repressor interactions that may occur at the FOLR1 and β-globin loci [70]–[72]. Stepwise assembly mechanisms are consistent with the observed sequential pathway of repressive chromatin modification. It is possible that the propagation of H4K20me3 might require prior H3K9me3, which requires prior H3K9me2 at this locus. While further investigations will be required to define the exact pathway of repressive mark assembly, it is clear that HS4 acts a chain terminator to heterochromatin spreading by using a panel of active histone modifications, which collaborate to block and inhibit repressive histone methylation.
There may be a role for RNA-directed heterochromatin assembly at the FOLR1 and β-globin loci. It was recently shown that the maintenance of heterochromatin region's condensed conformation requires RNAi factors [65]. This suggests conservation with mechanisms employed in fission yeast where RNAi factors work together with heterochromatin proteins including the HP1 homolog Swi6 to mediate heterochromatin establishment [8]. However, RNAi factors are dispensable for the maintenance of heterochromatin [73]. It remains to be investigated whether RNA and RNAi factors play a role in heterochromatin spreading in higher eukaryotes.
It is also conceivable that the continuous spreading of heterochromatin is dictated by the three dimensional organization of the FOLR1 and β-globin loci. If these gene loci are insulated from the upstream condensed region by positioning into different nuclear compartments, disruption of the active signature at the HSA/HSB and HS4 boundaries may result in the transfer of most or all the FOLR1 and β-globin loci into a repressive compartment. Such a scenario appears complex, however, as it would require the sequential transfer of these loci into different compartments rich in H3K9me2, H3K9me3 and H4K20me3 methyltransferases.
There is a paucity of information about the elements that form chromatin boundaries in vertebrates. Our finding that the HSA/HSB and HS4 boundary elements employ H2B ubiquitination to direct a cascade of active histone modifications suggests that genomic profiling of chromatin signatures will be a useful approach to identifying boundary elements. We note that there was a gross increase in total heterochromatin marks results when H2Bub1 is depleted for long periods. This observation suggests that many loci employ H2Bub1-dependent boundaries to heterochromatin spreading. It will be interesting to see whether other chromatin boundaries in vertebrate genomes also require such a large complement of active marks or employ a more restricted palette to deal with locus-specific threats.
Materials and Methods
Antibodies
Antibodies against H3K4me2 (07-030), H3K4me3 (05-745R), H3K9me3 (07-523), H3K27me3 (07-449), H3 (07-690), H3K9acK14ac (06-599), H4K5acK8acK12acK16ac (06-598), H2AK119ub (05-678), H2A.Z (07-594) and CTCF (06-917) were obtained from Millipore. Antibodies against H3K9me2 (ab1220), H3K79me2 (ab3594), H3K79me3 (ab2621), H2A.ZK4acK7acK11ac (ab18262), PAF1 (ab20662), RPB1 (ab5408) and TBP (ab51841) were obtained from Abcam. Antibodies against H4K20me3 were a kind gift from Judd Rice [74]. Antibodies against ubiquitin (sc-8017), (BML-PW8805) and USF1 (H00007391-A01) were obtained from Santa Cruz, Enzo Life Sciences and Abnova, respectively. Antibodies against RNF20 (A300-715A) and RBBP5 (A300-109A) were obtained from Bethyl Laboratories. Anti-H2BK120ub1 antibodies were initially a kind gift from Moshe Oren [62] then purchased from Médimabs (MM-0029) or Millipore (17-650). Anti-VEZF1 antibodies were raised as described [21]. PE conjugated anti-CD25 (IL-2R) was obtained from Dako.
Crosslinking chromatin immunoprecipitation
Chicken 6C2 erythroleukaemia cells were grown in αMEM supplemented with 10% FCS, 2% chicken serum, 1 mM HEPES, 25 µM β-mercaptoethanol and 1% Penicillin/Streptomycin solution. Crosslinking chromatin immunoprecipitation was performed as described previously [Litt et al, 2001]. Briefly, 6C2 cells (2×107 cells/ml) were crosslinked in fresh growth medium with 1% formaldehyde at room temperature for 20 minutes (RNF20, PAF1 and RBBP5), 10 minutes (CTCF, USF1 and VEZF1) or 2 minutes (H2Bub). Reactions were quenched by adding glycine to a final concentration 0.125 M. The crosslinked cells were washed by PBS twice and then lysed (0.25% Triton X-100, 10 mM EDTA, 0.5 mM EGTA and 10 mM Tris pH 8). Cell nuclei collected by centrifugation were washed (0.2 M NaCl, 1 mM EDTA, 0.5 mM EGTA and 10 mM Tris pH 8) followed by chromatin solubilization (0.5% SDS, 10 mM EDTA and 50 mM Tris pH 8). Chromatin was fragmented by sonication (Misonix) for a total time of 10 minutes in regular 10 second pulses. Insoluble material was removed by centrifugation at 15,000 g for 10 minutes at 4°C. Sizes of chromatin fragments were ∼500 bp on average.
Soluble chromatin was diluted by X-ChIP buffer (1.1% Triton X-100, 1.2 mM EDTA, 167 mM NaCl, 0.01% SDS and 16.7 mM Tris pH8) to obtain chromatin from 1×107 cells per ml. 1 ml of chromatin was pre-cleared with 5 µg of non-immune IgG and 100 µl (50% slurry in X-ChIP) of protein A/G agarose at 4°C for 3 hours. 10 µg of specific antibody was incubated with pre-cleared chromatin at 4°C with agitation overnight. Binding of protein A/G agarose was carried out at 4°C for 2 hours. The agarose was washed extensively with buffer 1 (1% Triton X-100, 0.1% SDS, 2 mM EDTA, 150 mM NaCl and 20 mM Tris pH 8), buffer 2 (1% Triton X-100, 0.1% SDS, 2 mM EDTA, 500 mM NaCl and 20 mM Tris pH 8), buffer 3 (0.25 M LiCl, 1% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA, 10 mM Tris pH 8) and twice with TE buffer (10 mM Tris pH 8, 1 mM EDTA). The bound chromatin was eluted into elution buffer (1% SDS, 0.1 M NaHCO3), crosslinks reversed and protein digested. DNA was extracted by phenol/chloroform and ethanol precipitated in the presence of 10 µg of glycogen for quantitative PCR (qPCR) analysis.
Low-salt native chromatin immunoprecipitation
Circulating red blood cells and whole brain tissue (without major vasculature) were collected from 10 day fertilized chick embryos kindly provided by Aviagen, Ltd. Native nucleosomes were prepared in low salt conditions to ensure retention of all nucleosomes, as described [34]. In brief, cells were collected in the presence of inhibitors (25 µg/ml AEBSF, 0.5 µg/ml Leupeptin and 0.7 µg/ml Pepstatin, 10 mM N-ethylmaleimide and 10 mM sodium butyrate) and nuclei were isolated by lysis buffer (10 mM NaCl, 3 mM MgCl2, 0.4% NP-40 and 10 mM Tris pH 7.5) for MNase (Sigma) digestion in the presence of 1 mM CaCl2. The MNase concentration (X) required to yield mostly di - and tri-nucleosomes was firstly determined. For ChIP experiments, three equal aliquots of nuclei were incubated with ½X, 1X and 2X MNase at 37°C for 17 minutes to obtain representative di - and tri-nucleosomes [14]. Digestion was stopped with 10 mM EDTA. Soluble chromatin was collected by centrifugation at 2,500 g for 5 minutes. The three supernatants were combined (S1). The remaining pellets were combined and resuspended in lysis buffer supplemented with 10 mM EDTA and left on ice for 15 minutes. Chromatin was released by passing through 20 then 25 gauge needles, and collected by centrifugation at 10,000 g for 10 minutes. The supernatant (S2) was combined with S1 for sucrose gradient fractionation. ∼1.5 mg of S1–S2 chromatin was fractionated on 13.5 ml 5∼25% linear sucrose gradients (Biocomp gradient master) in a SW40Ti rotor at 31,000 rpm for 14 hours at 4°C. 1 ml fractions were collected and 10 µl aliquots were extracted for checking DNA fragment sizes. Fractions containing di - and tri-nucleosomes were pooled and fixed with 0.1% formaldehyde at room temperature for 10 minutes. The crosslinking reaction was stopped with 0.125 M glycine. Nucleosomes were exchanged into N-ChIP buffer (50 mM NaCl, 5 mM EDTA, 10 mM Tris pH 7.5) buffer using P-6DG Bio-Gel (BioRad).
50 µg of nucleosomes were pre-cleared with 5 µg of non-immune IgG and 100 µl (50% slurry in N-ChIP buffer) of protein A/G agarose at 4°C for 3 hours. 10 µg of specific antibody was incubated with pre-cleared chromatin at 4°C with agitation overnight. Binding of protein A/G agarose was carried out at 4°C for 2 hours. Immunoprecipitated chromatin was collected and washed 5 times with 1 ml N-ChIP wash buffer (150 mM NaCl, 0.2 mM EDTA, 0.1% Tween-20 and 20 mM Tris pH 7.4). Chromatin was eluted with N-ChIP buffer supplemented with 1% SDS followed by 0.5% SDS. Eluates were digested with Proteinase K at 45°C for 2 hours and DNA extracted by phenol/chloroform and precipitated for qPCR analysis.
Quantitative PCR analysis
Relative DNA enrichments were quantified in triplicate by TaqMan real-time PCR on a Roche 480 Lightcycler. The primers used in this study were described previously [14], [21]. The comparative Ct method (with correction for primer efficiencies) was used to calculate fold enrichments and their standard deviations, as described previously [24]. Two sample equal variance Student's t-tests using a two-tailed distribution were applied to ChIP enrichment values to assess the significance of enrichments over controls, or changes following RNF20 knockdown. The calculated p-value ranges for enriched sites are indicated in the figure legends.
RNA interference
The pSLIK micro RNA-based lentiviral expression system was used to mediate long term conditional knockdown of RNF20 in chicken cells [75]. Gene-specific shRNAs are embedded into the primary transcript of human miR30, which is located in the 3′UTR of a doxycycline-regulated GFP transgene. The psm2 shRNA design tool was used to identify 20 potential shRNA targets (http://hannonlab.cshl.edu). These were scored and four targets were cloned into pEN_hUmiRc2, packaged into lentivirus particles and tested for performance as previously described [21]. GgRNF20-2628, which targets CAGAGTAACTAGAGAGAAA, was the most potent miR-shRNA and was used throughout this study. Wild type or 8103 (containing a single copy HS4 flanked IL-2R reporter transgene, [24]) 6C2 cells were transduced with GgRNF20-2628 lentiviral particles and cloned following flow sorting or serial dilution. GFP-miRNA expression was induced with 2 µg/ml doxycycline. GFP expression was monitored by FACS analysis to confirm expression of the miRNA cassette and RNF20 protein levels were monitored by Western blotting during prolonged knockdown time courses.
Western blotting
Nuclear extracts were prepared from cells harvested and washed with PBS and then lysed with hypotonic buffer (0.2% NP-40, 0.1 mM EDTA and 20 mM HEPES pH 8). Cell nuclei were collected by centrifugation at 2,500 g for 5 minutes. Nuclear proteins were extracted by incubation in high salt buffer (0.2% NP-40, 0.4 M NaCl, 13.3% glycerol and 20 mM HEPES pH 8) at 4°C for 30 minutes. Insoluble debris was removed by centrifugation at 16,000 g for 10 minutes at 4°C. Soluble nuclear extract was quantified by Bradford assay (Bio-Rad). 25 µg of nuclear extract or 7 µg of native S1–S2 nucleosome preparations were used for separation by SDS-PAGE. Proteins were then transferred to a PVDF membrane and imaged with HRP-conjugated secondary antibodies on a LAS-3000 imager (Fujifilm). Band intensities corrected for background were quantified using AIDA software.
FACS analysis
106 cells were harvested by centrifugation at 1,000 g for 5 minutes. Cells were washed twice in 1 ml of Hank's buffered saline solution (Sigma) supplemented with 0.1% BSA and 0.1% NaN3 (HBSS+). Cells were resuspended in 100 µl of HBSS+ and incubated with 10 µl of anti-CD25-PE (Dako) antibody in the dark at 4°C for 30 minutes. Excess antibody was removed by washing twice with 1 ml of HBSS+. After the last wash, cells were resuspended in 500 µl of HBSS+ for FACS analysis. Flow cytometry was performed on a FACSCalibur flow cytometer (BD Biosciences) using CELLQuest software. RNF20 knockdown cells express GFP upon induction with doxycycline. Color compensation was used to correct for GFP fluorescence in the FL2 (585 nm) filter; it was set as FL1 – 1% FL2 and FL2–20% FL1. Data was acquired for 10,000 viable or GFP-expressing cells (FL1 = 530 nm). Histograms were generated using FlowJo software (Tree Star, Inc). Mean IL-2R fluorescence intensities of RNF20 knockdown cells were determined and normalized to those of parental reporter transgene cells with wild type RNF20 levels.
RT-PCR
Total RNA was isolated from 6C2 cells using TRI reagent (Sigma) and cDNA prepared using SuperScript III (Invitrogen) and random hexamers. The following primers were used SYBR green real time PCR assays:
5′ TGCTGCGCTCGTTGTTGA
5′ CATCGTCCCCGGCGA
5′ ATGCGTCATCTCATCAGCAG
5′ TTGGGAAGAAGGGTCATCAG
5′ GATTCTGCATGTGCCACTGT
5′ AAGACCTGGGTGAAGGGTCT
Supporting Information
Zdroje
1. DeSBabuMM 2010 Genomic neighbourhood and the regulation of gene expression. Curr Opin Cell Biol 22 326 333
2. de WitEvan SteenselB 2009 Chromatin domains in higher eukaryotes: insights from genome-wide mapping studies. Chromosoma 118 25 36
3. HawkinsRDHonGCLeeLKNgoQListerR 2010 Distinct epigenomic landscapes of pluripotent and lineage-committed human cells. Cell Stem Cell 6 479 491
4. Peric-HupkesDMeulemanWPagieLBruggemanSWSoloveiI 2010 Molecular maps of the reorganization of genome-nuclear lamina interactions during differentiation. Mol Cell 38 603 613
5. FilionGJvan BemmelJGBraunschweigUTalhoutWKindJ 2010 Systematic protein location mapping reveals five principal chromatin types in Drosophila cells. Cell 143 212 224
6. KleinjanDALetticeLA 2008 Long-range gene control and genetic disease. Adv Genet 61 339 388
7. GiermanHJIndemansMHKosterJGoetzeSSeppenJ 2007 Domain-wide regulation of gene expression in the human genome. Genome Res 17 1286 1295
8. GrewalSIJiaS 2007 Heterochromatin revisited. Nat Rev Genet 8 35 46
9. GasznerMFelsenfeldG 2006 Insulators: exploiting transcriptional and epigenetic mechanisms. Nat Rev Genet 7 703 713
10. ValenzuelaLKamakakaRT 2006 Chromatin insulators. Annu Rev Genet 40 107 138
11. WallaceJAFelsenfeldG 2007 We gather together: insulators and genome organization. Curr Opin Genet Dev 17 400 407
12. WestAGFraserP 2005 Remote control of gene transcription. Hum Mol Genet 14 Spec No 1 R101 111
13. LittMDSimpsonMGasznerMAllisCDFelsenfeldG 2001 Correlation between histone lysine methylation and developmental changes at the chicken beta-globin locus. Science 293 2453 2455
14. LittMDSimpsonMRecillas-TargaFPrioleauMNFelsenfeldG 2001 Transitions in histone acetylation reveal boundaries of three separately regulated neighboring loci. EMBO J 20 2224 2235
15. PrioleauMNNonyPSimpsonMFelsenfeldG 1999 An insulator element and condensed chromatin region separate the chicken beta-globin locus from an independently regulated erythroid-specific folate receptor gene. EMBO J 18 4035 4048
16. ChungJHWhiteleyMFelsenfeldG 1993 A 5′ element of the chicken beta-globin domain serves as an insulator in human erythroid cells and protects against position effect in Drosophila. Cell 74 505 514
17. PikaartMJRecillas-TargaFFelsenfeldG 1998 Loss of transcriptional activity of a transgene is accompanied by DNA methylation and histone deacetylation and is prevented by insulators. Genes Dev 12 2852 2862
18. Recillas-TargaFPikaartMJBurgess-BeusseBBellACLittMD 2002 Position-effect protection and enhancer blocking by the chicken beta-globin insulator are separable activities. Proc Natl Acad Sci U S A 99 6883 6888
19. BellACWestAGFelsenfeldG 1999 The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98 387 396
20. YaoSOsborneCSBharadwajRRPasceriPSukonnikT 2003 Retrovirus silencer blocking by the cHS4 insulator is CTCF independent. Nucleic Acids Res 31 5317 5323
21. DicksonJGowherHStrogantsevRGasznerMHairA 2010 VEZF1 elements mediate protection from DNA methylation. PLoS Genet 6 e1000804 doi:10.1371/journal.pgen.1000804
22. HuangSLiXYusufzaiTMQiuYFelsenfeldG 2007 USF1 recruits histone modification complexes and is critical for maintenance of a chromatin barrier. Mol Cell Biol 27 7991 8002
23. HuangSLittMFelsenfeldG 2005 Methylation of histone H4 by arginine methyltransferase PRMT1 is essential in vivo for many subsequent histone modifications. Genes Dev 19 1885 1893
24. WestAGHuangSGasznerMLittMDFelsenfeldG 2004 Recruitment of histone modifications by USF proteins at a vertebrate barrier element. Mol Cell 16 453 463
25. BruceKMyersFAMantouvalouELefevrePGreavesI 2005 The replacement histone H2A.Z in a hyperacetylated form is a feature of active genes in the chicken. Nucleic Acids Res 33 5633 5639
26. LeeJSSmithEShilatifardA 2010 The language of histone crosstalk. Cell 142 682 685
27. OsleyMA 2006 Regulation of histone H2A and H2B ubiquitylation. Brief Funct Genomic Proteomic 5 179 189
28. ShilatifardA 2006 Chromatin modifications by methylation and ubiquitination: implications in the regulation of gene expression. Annu Rev Biochem 75 243 269
29. KimJGuermahMMcGintyRKLeeJSTangZ 2009 RAD6-Mediated transcription-coupled H2B ubiquitylation directly stimulates H3K4 methylation in human cells. Cell 137 459 471
30. WeakeVMWorkmanJL 2008 Histone ubiquitination: triggering gene activity. Mol Cell 29 653 663
31. KouzaridesT 2007 Chromatin modifications and their function. Cell 128 693 705
32. TavernaSDLiHRuthenburgAJAllisCDPatelDJ 2007 How chromatin-binding modules interpret histone modifications: lessons from professional pocket pickers. Nat Struct Mol Biol 14 1025 1040
33. VermeulenMEberlHCMatareseFMarksHDenissovS 2010 Quantitative Interaction Proteomics and Genome-wide Profiling of Epigenetic Histone Marks and Their Readers. Cell 142 967 980
34. JinCFelsenfeldG 2007 Nucleosome stability mediated by histone variants H3.3 and H2A.Z. Genes Dev 21 1519 1529
35. GroudineMWeintraubH 1981 Activation of globin genes during chicken development. Cell 24 393 401
36. ZhuBZhengYPhamADMandalSSErdjument-BromageH 2005 Monoubiquitination of human histone H2B: the factors involved and their roles in HOX gene regulation. Mol Cell 20 601 611
37. KimJHakeSBRoederRG 2005 The human homolog of yeast BRE1 functions as a transcriptional coactivator through direct activator interactions. Mol Cell 20 759 770
38. Recillas-TargaFValadez-GrahamVFarrellCM 2004 Prospects and implications of using chromatin insulators in gene therapy and transgenesis. Bioessays 26 796 807
39. AmouyalM 2010 Gene insulation. Part I: natural strategies in yeast and Drosophila. Biochem Cell Biol 88 875 884
40. DhillonNRaabJGuzzoJSzyjkaSJGangadharanS 2009 DNA polymerase epsilon, acetylases and remodellers cooperate to form a specialized chromatin structure at a tRNA insulator. EMBO J 28 2583 2600
41. OkiMValenzuelaLChibaTItoTKamakakaRT 2004 Barrier proteins remodel and modify chromatin to restrict silenced domains. Mol Cell Biol 24 1956 1967
42. LinNLiXCuiKChepelevITieF 2011 A Barrier-only Boundary Element Delimits the Formation of Facultative Heterochromatin in Drosophila and Vertebrates. Mol Cell Biol
43. HwangWWVenkatasubrahmanyamSIanculescuAGTongABooneC 2003 A conserved RING finger protein required for histone H2B monoubiquitination and cell size control. Mol Cell 11 261 266
44. DionMFKaplanTKimMBuratowskiSFriedmanN 2007 Dynamics of replication-independent histone turnover in budding yeast. Science 315 1405 1408
45. OkiMKamakakaRT 2005 Barrier function at HMR. Mol Cell 19 707 716
46. ZhouBOWangSSXuLXMengFLXuanYJ 2010 SWR1 complex poises heterochromatin boundaries for antisilencing activity propagation. Mol Cell Biol 30 2391 2400
47. HenryKWBergerSL 2002 Trans-tail histone modifications: wedge or bridge? Nat Struct Biol 9 565 566
48. SunZWAllisCD 2002 Ubiquitination of histone H2B regulates H3 methylation and gene silencing in yeast. Nature 418 104 108
49. ChandrasekharanMBHuangFSunZW 2009 Ubiquitination of histone H2B regulates chromatin dynamics by enhancing nucleosome stability. Proc Natl Acad Sci U S A 106 16686 16691
50. FlemingABKaoCFHillyerCPikaartMOsleyMA 2008 H2B ubiquitylation plays a role in nucleosome dynamics during transcription elongation. Mol Cell 31 57 66
51. TannyJCErdjument-BromageHTempstPAllisCD 2007 Ubiquitylation of histone H2B controls RNA polymerase II transcription elongation independently of histone H3 methylation. Genes Dev 21 835 847
52. ChandrasekharanMBHuangFChenYCSunZW 2010 Histone H2B C-terminal helix mediates trans-histone H3K4 methylation independent of H2B ubiquitination. Mol Cell Biol 30 3216 3232
53. NakanishiSSandersonBWDelventhalKMBradfordWDStaehling-HamptonK 2008 A comprehensive library of histone mutants identifies nucleosomal residues required for H3K4 methylation. Nat Struct Mol Biol 15 881 888
54. ShahbazianMDZhangKGrunsteinM 2005 Histone H2B ubiquitylation controls processive methylation but not monomethylation by Dot1 and Set1. Mol Cell 19 271 277
55. LeeJSShuklaASchneiderJSwansonSKWashburnMP 2007 Histone crosstalk between H2B monoubiquitination and H3 methylation mediated by COMPASS. Cell 131 1084 1096
56. WuMWangPFLeeJSMartin-BrownSFlorensL 2008 Molecular regulation of H3K4 trimethylation by Wdr82, a component of human Set1/COMPASS. Mol Cell Biol 28 7337 7344
57. RuthenburgAJAllisCDWysockaJ 2007 Methylation of lysine 4 on histone H3: intricacy of writing and reading a single epigenetic mark. Mol Cell 25 15 30
58. LathamJADentSY 2007 Cross-regulation of histone modifications. Nat Struct Mol Biol 14 1017 1024
59. HungTBindaOChampagneKSKuoAJJohnsonK 2009 ING4 mediates crosstalk between histone H3 K4 trimethylation and H3 acetylation to attenuate cellular transformation. Mol Cell 33 248 256
60. WangZZangCCuiKSchonesDEBarskiA 2009 Genome-wide mapping of HATs and HDACs reveals distinct functions in active and inactive genes. Cell 138 1019 1031
61. WysockaJSwigutTXiaoHMilneTAKwonSY 2006 A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 442 86 90
62. MinskyNShemaEFieldYSchusterMSegalE 2008 Monoubiquitinated H2B is associated with the transcribed region of highly expressed genes in human cells. Nat Cell Biol 10 483 488
63. SchulzeJMJacksonJNakanishiSGardnerJMHentrichT 2009 Linking cell cycle to histone modifications: SBF and H2B monoubiquitination machinery and cell-cycle regulation of H3K79 dimethylation. Mol Cell 35 626 641
64. ChungJHBellACFelsenfeldG 1997 Characterization of the chicken beta-globin insulator. Proc Natl Acad Sci U S A 94 575 580
65. GilesKEGhirlandoRFelsenfeldG 2010 Maintenance of a constitutive heterochromatin domain in vertebrates by a Dicer-dependent mechanism. Nat Cell Biol 12 94 99; sup pp 91–96
66. WeakeVMWorkmanJL 2010 Inducible gene expression: diverse regulatory mechanisms. Nat Rev Genet 11 426 437
67. Rodriguez-NavarroS 2009 Insights into SAGA function during gene expression. EMBO Rep 10 843 850
68. WoodASchneiderJDoverJJohnstonMShilatifardA 2005 The Bur1/Bur2 complex is required for histone H2B monoubiquitination by Rad6/Bre1 and histone methylation by COMPASS. Mol Cell 20 589 599
69. TalbertPBHenikoffS 2006 Spreading of silent chromatin: inaction at a distance. Nat Rev Genet 7 793 803
70. HinesKACrydermanDEFlanneryKMYangHVitaliniMW 2009 Domains of heterochromatin protein 1 required for Drosophila melanogaster heterochromatin spreading. Genetics 182 967 977
71. KwonSHWorkmanJL 2008 The heterochromatin protein 1 (HP1) family: put away a bias toward HP1. Mol Cells 26 217 227
72. SchottaGLachnerMSarmaKEbertASenguptaR 2004 A silencing pathway to induce H3-K9 and H4-K20 trimethylation at constitutive heterochromatin. Genes Dev 18 1251 1262
73. HallIMShankaranarayanaGDNomaKAyoubNCohenA 2002 Establishment and maintenance of a heterochromatin domain. Science 297 2232 2237
74. SimsJKHoustonSIMagazinnikTRiceJC 2006 A trans-tail histone code defined by monomethylated H4 Lys-20 and H3 Lys-9 demarcates distinct regions of silent chromatin. J Biol Chem 281 12760 12766
75. ShinKJWallEAZavzavadjianJRSantatLALiuJ 2006 A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Proc Natl Acad Sci U S A 103 13759 13764
Štítky
Genetika Reprodukční medicína
Článek Pervasive Sign Epistasis between Conjugative Plasmids and Drug-Resistance Chromosomal MutationsČlánek Stress-Induced PARP Activation Mediates Recruitment of Mi-2 to Promote Heat Shock Gene ExpressionČlánek A Functional Variant at a Prostate Cancer Predisposition Locus at 8q24 Is Associated with ExpressionČlánek Replication and Explorations of High-Order Epistasis Using a Large Advanced Intercross Line PedigreeČlánek Expression of Tumor Suppressor in Spermatogonia Facilitates Meiotic Progression in Male Germ Cells
Článek vyšel v časopisePLOS Genetics
Nejčtenější tento týden
2011 Číslo 7
-
Všechny články tohoto čísla
- Gene-Based Tests of Association
- The Demoiselle of X-Inactivation: 50 Years Old and As Trendy and Mesmerising As Ever
- Variants in and Underlie Natural Variation in Translation Termination Efficiency in
- SHH1, a Homeodomain Protein Required for DNA Methylation, As Well As RDR2, RDM4, and Chromatin Remodeling Factors, Associate with RNA Polymerase IV
- Genome-Wide Association Study Identifies as a Susceptibility Gene for Pediatric Asthma in Asian Populations
- Pervasive Sign Epistasis between Conjugative Plasmids and Drug-Resistance Chromosomal Mutations
- Genetic Anticipation Is Associated with Telomere Shortening in Hereditary Breast Cancer
- Identification of a Mutation Associated with Fatal Foal Immunodeficiency Syndrome in the Fell and Dales Pony
- Stress-Induced PARP Activation Mediates Recruitment of Mi-2 to Promote Heat Shock Gene Expression
- An Epigenetic Switch Involving Overlapping Fur and DNA Methylation Optimizes Expression of a Type VI Secretion Gene Cluster
- Recombination and Population Structure in
- A Rice Plastidial Nucleotide Sugar Epimerase Is Involved in Galactolipid Biosynthesis and Improves Photosynthetic Efficiency
- A Role for Phosphatidic Acid in the Formation of “Supersized” Lipid Droplets
- Colon Stem Cell and Crypt Dynamics Exposed by Cell Lineage Reconstruction
- Loss of the BMP Antagonist, SMOC-1, Causes Ophthalmo-Acromelic (Waardenburg Anophthalmia) Syndrome in Humans and Mice
- Interactions between Glucocorticoid Treatment and Cis-Regulatory Polymorphisms Contribute to Cellular Response Phenotypes
- Translation Reinitiation Relies on the Interaction between eIF3a/TIF32 and Progressively Folded -Acting mRNA Elements Preceding Short uORFs
- DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions
- Adult Circadian Behavior in Requires Developmental Expression of , But Not
- Histone Crosstalk Directed by H2B Ubiquitination Is Required for Chromatin Boundary Integrity
- Proteins in the Nutrient-Sensing and DNA Damage Checkpoint Pathways Cooperate to Restrain Mitotic Progression following DNA Damage
- Complex Evolutionary Events at a Tandem Cluster of Genes Resulting in a Single-Locus Genetic Incompatibility
- () and Its Regulated Homeodomain Gene Mediate Abscisic Acid Response in
- A Functional Variant at a Prostate Cancer Predisposition Locus at 8q24 Is Associated with Expression
- LGI2 Truncation Causes a Remitting Focal Epilepsy in Dogs
- Adaptations to Endosymbiosis in a Cnidarian-Dinoflagellate Association: Differential Gene Expression and Specific Gene Duplications
- The Translation Initiation Factor eIF4E Regulates the Sex-Specific Expression of the Master Switch Gene in
- Somatic Genetics Empowers the Mouse for Modeling and Interrogating Developmental and Disease Processes
- Molecular Mechanisms Generating and Stabilizing Terminal 22q13 Deletions in 44 Subjects with Phelan/McDermid Syndrome
- Replication and Explorations of High-Order Epistasis Using a Large Advanced Intercross Line Pedigree
- Mechanisms of Chromosome Number Evolution in Yeast
- Regulatory Cross-Talk Links Chromosome II Replication and Segregation
- Ancestral Genes Can Control the Ability of Horizontally Acquired Loci to Confer New Traits
- Expression of Tumor Suppressor in Spermatogonia Facilitates Meiotic Progression in Male Germ Cells
- Rare and Common Regulatory Variation in Population-Scale Sequenced Human Genomes
- The Epistatic Relationship between BRCA2 and the Other RAD51 Mediators in Homologous Recombination
- Identification of Novel Genetic Markers Associated with Clinical Phenotypes of Systemic Sclerosis through a Genome-Wide Association Strategy
- NatF Contributes to an Evolutionary Shift in Protein N-Terminal Acetylation and Is Important for Normal Chromosome Segregation
- Araucan and Caupolican Integrate Intrinsic and Signalling Inputs for the Acquisition by Muscle Progenitors of the Lateral Transverse Fate
- Pathologic and Phenotypic Alterations in a Mouse Expressing a Connexin47 Missense Mutation That Causes Pelizaeus-Merzbacher–Like Disease in Humans
- Recombinant Inbred Line Genotypes Reveal Inter-Strain Incompatibility and the Evolution of Recombination
- Epistatic Relationships in the BRCA1-BRCA2 Pathway
- Genome-Wide Association Study Identifies Novel Restless Legs Syndrome Susceptibility Loci on 2p14 and 16q12.1
- Genetic Loci Associated with Plasma Phospholipid n-3 Fatty Acids: A Meta-Analysis of Genome-Wide Association Studies from the CHARGE Consortium
- Fine Mapping of Five Loci Associated with Low-Density Lipoprotein Cholesterol Detects Variants That Double the Explained Heritability
- CHD1 Remodels Chromatin and Influences Transient DNA Methylation at the Clock Gene
- Nonlinear Fitness Landscape of a Molecular Pathway
- Genome-Wide Scan Identifies , , and as Novel Risk Loci for Systemic Sclerosis
- Quantitative and Qualitative Stem Rust Resistance Factors in Barley Are Associated with Transcriptional Suppression of Defense Regulons
- A Systematic Screen for Tube Morphogenesis and Branching Genes in the Tracheal System
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- A Rice Plastidial Nucleotide Sugar Epimerase Is Involved in Galactolipid Biosynthesis and Improves Photosynthetic Efficiency
- Genome-Wide Association Study Identifies Novel Restless Legs Syndrome Susceptibility Loci on 2p14 and 16q12.1
- Loss of the BMP Antagonist, SMOC-1, Causes Ophthalmo-Acromelic (Waardenburg Anophthalmia) Syndrome in Humans and Mice
- Gene-Based Tests of Association
Přihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání