-
Články
Top novinky
Reklama- Vzdělávání
- Časopisy
Nové číslo
- Témata
Top novinky
Reklama- Videa
- Podcasty
Nové podcasty
Reklama- Práce v oboru
Doporučené pozice
Reklama- Praktické
Top novinky
ReklamaFluorescence fluctuation analysis reveals PpV dependent Cdc25 protein dynamics in living embryos
Authors: Boyang Liu aff001; Ingo Gregor aff003; H.-Arno Müller aff004; Jörg Großhans aff001
Authors place of work: Fachbereich Biologie (FB17), Philipps-Universität Marburg, Marburg, Germany aff001; Institut für Entwicklungsbiochemie, Universitätsmedizin, Georg-August-Universität Göttingen, Göttingen, Germany aff002; Drittes Physikalisches Institut, Georg-August-Universität Göttingen, Göttingen, Germany aff003; Fachgebiet Entwicklungsgenetik, Institut für Biologie, Universität Kassel, Kassel, Germany aff004
Published in the journal: Fluorescence fluctuation analysis reveals PpV dependent Cdc25 protein dynamics in living embryos. PLoS Genet 16(4): e32767. doi:10.1371/journal.pgen.1008735
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1008735Summary
The protein phosphatase Cdc25 is a key regulator of the cell cycle by activating Cdk-cyclin complexes. Cdc25 is regulated by its expression levels and post-translational mechanisms. In early Drosophila embryogenesis, Cdc25/Twine drives the fast and synchronous nuclear cycles. A pause in the cell cycle and the remodeling to a more generic cell cycle mode with a gap phase are determined by Twine inactivation and destruction in early interphase 14, in response to zygotic genome activation. Although the pseudokinase Tribbles contributes to the timely degradation of Twine, Twine levels are controlled by additional yet unknown post-translational mechanisms. Here, we apply a non-invasive method based on fluorescence fluctuation analysis (FFA) to record the absolute concentration profiles of Twine with minute-scale resolution in single living embryos. Employing this assay, we found that Protein phosphatase V (PpV), the homologue of the catalytic subunit of human PP6, ensures appropriately low Twine protein levels at the onset of interphase 14. PpV controls directly or indirectly the phosphorylation of Twine at multiple serine and threonine residues as revealed by phosphosite mapping. Mutational analysis confirmed that these sites are involved in control of Twine protein dynamics, and cell cycle remodeling is delayed in a fraction of the phosphosite mutant embryos. Our data reveal a novel mechanism for control of Twine protein levels and their significance for embryonic cell cycle remodeling.
Keywords:
Cell cycle and cell division – Drosophila melanogaster – Phosphatases – Embryos – Phosphorylation – Mitosis – Invertebrate genomics – Fluctuation analysis
Introduction
The progression of cell cycle and the change between cell cycle modes are controlled by activity and expression levels of regulatory proteins. The antagonistic pair of Wee1/Myt1 kinases and Cdc25 phosphatase is a paradigm for the post-translational control of the Cdk1-cyclin complex, acting on the T14Y15 sites of Cdk1 [1, 2]. Wee1 and Cdc25 themselves are regulated by phosphorylation and protein levels [3, 4]. Besides during normal cell cycle progression, the control of their activity and protein levels is especially important during remodeling of the cell cycle, such as during developmental transitions or in coordination with morphogenesis. A prominent and well-studied example is the remodeling during the transition from syncytial to cellular development in early Drosophila embryos, when the rapid nuclear cycle changes to a more generic mode with a G2 phase.
The 13 rounds of nuclear cycle proceed with fast S phases but lack gap phases and cytokinesis. After mitosis 13, the cell cycle changes to a mode with cytokinesis, a slow S phase, and a G2 phase [5, 6]. This change from fast nuclear cycles to slow embryonic cell cycle is linked to the onset of zygotic gene transcription, the degradation of maternal RNAs, consumption of maternal metabolites, and morphological changes [7–11]. The onset of zygotic transcription is necessary and sufficient for remodeling the cell cycle in that the DNA replication checkpoint is activated by an interference of transcription and replication [8, 12]. Furthermore, specific zygotic genes encoding mitotic inhibitors contribute to the inactivation of Cdk1-cyclin and cell cycle remodeling [13–15].
The post-translational control of Cdc25 is at the center of cell cycle remodeling regulation [16–19] (Fig 1A). Drosophila Cdc25 homologues are encoded by two genes, string and twine. Although both are abundantly expressed in mature oocytes and during nuclear cycles, Twine is specifically required for the nuclear cycles [18, 19]. Timely degradation of Twine in response to zygotic genome activation correlates to the decline of Cdk1 activity and consequent cell cycle remodeling [19–21]. The mechanism for the timely decay of Twine is unknown, yet the pseudokinase Tribbles (Trbl) makes a contribution [14, 22, 23]. Trbl antagonizes Cdc25/String and promotes Cdc25/Twine degradation in interphase 14 [15, 19]. However, the molecular mechanism of trbl function is poorly understood.
Fig. 1. Twine protein dynamics in PpV embryos. (A) Schematic temporal profile of Cdc25/Twine during Drosophila early embryogenesis. The levels of Twine are post-translationally regulated by unknown mechanisms. (B) Quantification of twine mRNA levels by quantitative RT-PCR. Normalized by GAPDH. Bars indicate mean values (1:0.94, N = 2). (C) Fixed wild type embryos and PpV mutants stained for Twine (white), Slam (red), and DNA (DAPI, blue). Sagittal sections with Slam staining and nuclear morphology allow approximate staging of the embryos. Slam is restricted to the furrow canal marking the advance of furrow invagination during cellularization. NC, nuclear cycle. Scale bar 50 μm. (D) Western blot showing Twine expression profiles of nuclear cycle 12 to 14 in wild type and PpV embryos. Embryos were manually staged according to the nuclear density. Pre-blastoderm embryos (pre), nuclear cycle 12, 13, 14 early (14e) and late (14l). Cross-reacting band (marked by *) serves as the loading control. In addition to trbl, Twine may be post-translationally controlled by other factors, since cell cycle remodeling does not exclusively depend on trbl (Fig 1A). In other systems, Cdc25 activity can be modulated through its phosphorylation state by other kinases and phosphatases at multiple amino acid residues [24]. Protein phosphatase V (PpV) encodes the Drosophila homologue of the catalytic subunit of human Protein Phosphatase 6 (PP6) [25–27]. We recently found that PpV is essential for Drosophila embryonic development and acts in parallel to trbl for timely cell cycle remodeling in interphase 14. Embryos lacking maternal PpV (embryos derived from PpV germline clones) are embryonic lethal before hatching. During blastoderm stage, about 30–50% of the embryos postpone cell cycle remodeling by one nuclear cycle [28].
Here, we hypothesize that PpV controls remodeling of the nuclear cycle through Cdc25/Twine. We investigate the functional and molecular relationship between PpV and twine. Given the phenotypic variability and the rapid change of Twine protein levels during early embryonic cleavage cycles, we applied fluorescence fluctuation analysis (FFA) as a non-invasive method to follow the absolute concentration of Twine-GFP in single living embryos from wild type, PpV and trbl mutants. We found that PpV is required for appropriately low Twine levels prior to trbl-mediated Twine destabilization and corresponding to cell cycle remodeling. We identified PpV dependent phosphosites in Twine by mass spectrometry. These phosphosites are relevant for controlling Cdc25/Twine protein dynamics and timing cell cycle remodeling as revealed in transgenic embryos.
Results
Persisting Cdc25/Twine protein levels in PpV mutants
The induced destabilization of Twine is achieved by a drop in the half life from about 20 min to 5 min in interphase 14, and trbl contributes to this destabilization [19, 21]. However, since only 10% of trbl mutants undergo an extra nuclear division, and trbl RNAi resulted only partial stabilization of Twine, other yet unknown factors may also play a role [19, 28]. Searching for additional factors, we found PpV to be involved in controlling Twine protein levels.
When investigating genetic interactions of PpV and twine, we found that twine is a mild dominant suppressor of PpV. We observed hatching larvae from PpV mutants that were heterozygous for twine (>20 out of 1000 eggs), whereas no hatching larvae were observed from PpV mutants in wild type background. This interaction occurs on post-translational level as mRNA levels of twine are similar, but protein levels are higher in PpV mutants than in wild type. Quantitative PCR detected comparable levels of twine mRNA in wild type and PpV embryos (Fig 1B). Using immunostaining with morphological markers (nuclear and furrow lengths), we found that Twine appeared to persist longer in many but not all cellularizing PpV embryos (Fig 1C). Whereas western blot analysis of embryos staged according to early and late cellularization did not reveal an obvious difference (Fig 1D).
The difference between western blot analysis and immunostaining may be due to imprecise staging or embryo-to-embryo variation, which is obvious in PpV mutants. Moreover, western blot employed lysates derived from multiple embryos, thus revealing averages. To circumvent the problems of precise staging, phenotypic variability, and reliable quantification, a non-invasive quantitative method is needed to follow the expression levels of Twine during the course of nuclear cycles and cellularization in single selected embryos. Ideally, absolute concentrations are measured to allow a direct comparison between genotypes and make measurements independent of imaging and experimental conditions.
Fluorescence fluctuation analysis (FFA) detects protein dynamics in vivo
We applied fluorescence fluctuation analysis (FFA), a simplified version of fluorescence correlation spectrometry (FCS), to trace the profiles of Twine-GFP protein in individual embryos with absolute time and concentration [29–32] (S1A Fig). Fluorescence fluctuations in a fixed focal volume depend on the fluorophore concentration, mobility, and volume size. From the fluctuation trace, the average number of molecules per focal volume can be determined. Knowing the focal volume, the absolute concentration can be calculated [33, 34]. For robust numbers, we averaged over multiple 10 sec fluctuation traces (S1E and S1F Fig), yielding a minute-scale temporal resolution. We experimentally determined a focal volume of 0.4±0.1 fl by measuring the xyz point spread functions of 100 nm microspheres in pre-blastoderm embryos [35] (S1B–S1D Fig).
We validated the FFA method with embryos containing one or two copies of nuclear GFP (nlsGFP) transgene. The copy number of nlsGFP transgene approximately corresponds to the protein content as confirmed by an about twofold increase in western blot (S1G Fig, S1 Data). Compared to this, FFA revealed a reliable twofold increase of the nuclear concentration, from 424±72 nM to 887±203 nM in embryos with one and two copies of the nlsGFP (S1H Fig, S1 Data). These data indicate that FFA can be applied in Drosophila embryos to non-invasively quantify absolute protein concentrations.
Next, we applied FFA to detect Twine protein levels. We employed a genomic Twine-GFP transgene, which functionally complements twine mutants (Fig 2A). We recorded fluorescence traces in embryos with one copy of Twine-GFP on top of two endogenous copies of twine at interphase 14. Having measured the relation of fluorescence and concentration in one pixel, we derived a spatial concentration map for the same image (Fig 2B). In this case, measurements revealed a concentration of 98.5 nM in the focal volume, and averaging over the field of view resulted in a nuclear concentration of 101 nM.
Fig. 2. Concentration profile of Twine-GFP by fluorescence fluctuation analysis. (A) Scheme of Twine-GFP genomic rescue construct. Twine open reading frame (ORF) is indicated in orange. Linker sequence (Stuffer) is indicated in blue box and EGFP is in green box. Untranslated regions (UTR) are indicated in grey boxes. 3,614 bp genomic region is depicted in grey line. (B) Spatial concentration map of Twine-GFP in cortical nuclei of a wild type embryo with one copy of Twine-GFP transgene at interphase 14/early cellularization. Heat-map showing the scale of calculated absolute concentration of Twine-GFP. White crosses indicate the position of measurement/focal volume. (C) Experimental scheme of temporal Twine profiles. Upper panel: Images from a recording and the recorded time points in interphase 14. Lower panel: Measured Twine-GFP concentration in a wild type embryo with one copy of Twine-GFP transgene. S, second. NC, nuclear cycle. We then determined the temporal concentration profile by repetitive measurements in interphases of the nuclear cycles and during cellularization/interphase 14. In a selected embryo, we measured the nuclear concentration of Twine-GFP starting with interphase 11 until late cellularization. In particular, during cellularization, we measured the concentration every few minutes to better follow the decay dynamics. We found that the nuclear concentration dropped from more than 300 nM in interphase 11, to about 150 nM at the onset of cellularization (Fig 2C). Afterwards, Twine-GFP rapidly dropped below the detection levels within 20 to 30 min in interphase 14. Our data are consistent with the published relative profiles of Twine-GFP [21].
Dynamics of Twine protein depends on PpV and tribbles
We tested the hypothesis that PpV is involved in controlling Twine protein levels by measuring Twine-GFP profiles in wild type, PpV and trbl mutant embryos using FFA. Although Twine-GFP levels were initially within the same range during nuclear cycles, we detected significantly higher levels in PpV embryos at early interphase 14. Here, Twine-GFP levels were in average 1.7-fold higher in PpV mutants than in wild type and trbl embryos (Fig 3A).
Fig. 3. Dynamics of Twine protein depends on PpV and tribbles. We analyzed the Twine profiles in a greater temporal resolution during cellularization/interphase 14, when Twine swiftly decays. To document embryo-to-embryo variations and for ease of comparison between the genotypes, we fitted an exponential function to the individual traces which yielded two parameters (Fig 3B). The initial concentration (co) is the Twine levels at the onset of interphase 14 (t = 0). The exponential constant (k) provides a phenological decay time, which represents the difference between translation and degradation rates. While half life refers to as the molecular lifetime of Twine protein molecules, the phenological decay time is based on a measurement of steady state concentration reflecting the bulk of Twine molecules. With the assumption of a constant translation rate, the changes in phenological decay time indicate changes in protein stability. To assess the phenotypic variability, we measured the profiles in 10 individual embryos for each genotype, at least.
We obtained a narrow distribution of initial concentrations of 160±21 nM and a decay time of less than 10 min in wild type embryos (Fig 3C and 3D, S1 Data). The distributions of these two parameters were much wider in the mutants. Especially, the initial concentration in PpV embryos appeared as an almost bimodal distribution ranging from 100 nM to more than 300 nM. The average initial concentration of 236±81 nM was significantly higher than the value in wild type and trbl embryos. Conversely, the average decay time was not significantly changed in PpV mutants. Consistent with previous reports of Trbl induced Twine degradation [19], the decay time was significantly increased to 13.5±4.27 min in trbl mutants as compared to wild type (Fig 3C and 3D). These data indicate that PpV and trbl control the protein amount of Twine in two different manners. PpV ensures appropriately low levels of Twine prior to interphase 14, whereas trbl contributes to the induced Twine degradation in response to zygotic genome activation during cellularization.
PpV mutants are characterized by an extra nuclear cycle in about 30–50% of the embryos [28]. Given the bimodal distribution of initial Twine concentration, we hypothesized that PpV mutants with increased initial Twine levels were more likely to undergo an extra division than that PpV mutants with normal levels of Twine. To establish the correlation between initial Twine levels and the cell cycle phenotype, we measured Twine-GFP levels 5 min after mitosis 13 and scored the embryonic cell cycle later on (Fig 3E). In both populations of PpV embryos (13 versus 14 divisions), we observed wide and overlapping distributions of Twine-GFP (Fig 3F, S1 Data). Importantly, the averaged Twine concentration was significantly higher in embryos with an extra division. These data indicate that the embryos with higher Twine levels are more likely to undergo an extra division, consistent with the function of Twine as an activator of Cdk1. However, the overlapping distributions also suggest that other, yet unknown, factors besides Twine contribute to the control of mitotic entry. Taken together, our measurements indicate that PpV controls Twine protein levels and ensures a low embryo-to-embryo variability prior to interphase 14.
Twine is hyperphosphorylated in PpV mutants
As a first step into the molecular mechanism, we analyzed the phosphorylation state of Twine in early Drosophila embryos. We isolated Twine-GFP with a single chain GFP nanobody from wild type and PpV mutant embryos (Fig 4A), and subjected the isolated protein to phosphopeptide analysis by mass spectrometry. We achieved about 70% coverage and detected several phosphopeptides (Fig 4B, S1 Table). Two paired phosphosites were identified in both wild type and PpV embryos: Thr203+Ser205 and Thr394+Ser396 (Fig 4B, S2 Table), indicating constitutive phosphorylation which does not depend on PpV. In addition, we identified eight sites specifically in PpV mutants, indicating that their dephosphorylation depends on PpV. These eight PpV dependent phosphosites clustered in three regions. The experimental data are strong and unambiguous for Ser41 and a paired site close to the C-terminus, Ser405 and Ser412. The other five sites clustered in a region between 59 and 67. The phosphosite mapping result indicates that at least one among the five residues in that region are hyperphosphorylated in PpV mutants (Fig 4B, S2 Table). Thus, our data indicate that PpV is required for dephosphorylation of Twine at three positions, at least. Our experimental approach does not allow to distinguish, however, whether PpV acts directly on Twine or indirectly via additional and unknown protein kinases or phosphatases.
Fig. 4. Identification of PpV dependent phosphorylation sites in Twine. Having revealed Twine hyperphosphorylation in PpV mutants, we further tested the functional relevance of these sites on Twine protein dynamics and the timing of cell cycle remodeling. We mutated the amino acid residues of all eight PpV dependent phosphosites in Twine. We generated Twine-GFP genomic transgenes, in which the respective serine/threonine residues were mutated to either aspartic acid (Twine-GFP-8×Asp, phosphomimetic) or alanine (Twine-GFP-8×Ala, non-phosphorylatable) (Figs 2A and 4C). We crossed the transgenes into twine mutant background and tested for complementation. One copy of both transgenes complemented the twine female sterility. When making the transgenes homozygous (two copies of the transgenes), we observed a dose dependent lethality of the phosphomimetic Twine-GFP-8×Asp but not by the non-phosphorylatable or wild type transgene. Such a neomorphic phenotype indicates that the Twine-GFP-8×Asp protein has acquired novel activities such as novel substrates, making interpretation of the phenotypes difficult.
We quantified Twine protein levels by FFA in embryos expressing one copy of mutated Twine-GFP in wild type background. We detected strongly increased levels of the non-phosphorylatable Twine-GFP-8×Ala protein already during nuclear cycle 11. In contrast, levels of the phosphomimetic form were strongly reduced but remained constant during nuclear cycles (Fig 4D, S1 Data). At cycle 14, when wild type Twine-GFP levels have dropped to about 119±28 nM, both mutant protein forms were significantly higher with 206±58 nM for the 8×Ala and 169±36 nM for the 8×Asp Twine-GFP transgenes, respectively. Consistent with the higher initial concentrations of Twine-GFP at the onset of interphase 14, we observed an extra mitosis in a small fraction of the embryos for both phosphomimetic (7%, N = 14) and non-phosphorylatable Twine-GFP (17%, N = 23).
In summary, we detected PpV dependent phosphosites in Twine, which are relevant for protein stability and for Twine’s function in mitotic control. Mutation of these phosphosites leads to changes of protein levels and corresponding to an extra nuclear division prior to cellularization, albeit at low penetrance. We conclude that these phosphosites are important and physiologically relevant for ensuring the proper developmental profile of Cdc25/Twine protein levels, and thus proper developmental control of nuclear cycles.
Discussion
In this study, we provide a versatile quantitative and non-invasive method, fluorescence fluctuation analysis (FFA), for measuring absolute protein concentration with a high spatiotemporal resolution. We applied FFA to detect the absolute concentration of tagged Cdc25/Twine in living embryos, and correlated the Twine concentration to the developmental path. Because this approach is based on frequency but not amplitude of the fluorescent signal [29, 31], experimental conditions such as changing laser power or photo-bleaching do not obscure the measurements.
Cdc25 activity is determined by protein amount as well as post-translational modifications such as phosphorylation [24, 36–39]. However, it is yet unclear how the activity and amount of Cdc25/Twine are regulated in early Drosophila embryos. As Twine protein and mRNA are maternally provided and twine RNAi does not alter cell cycle remodeling [19], its regulation in early embryos is achieved post-translationally. Firstly, Twine protein levels are set low at the onset to allow a swift degradation within the first 20 min of cellularization/interphase 14. Secondly, the half life of Twine strongly decreases in interphase 14 in response to the onset of zygotic gene expression. The molecular mechanisms for both modes have remained unclear. Analysis has been hampered by the lack of a simple and non-invasive assay to measure the changing of Twine protein levels and correlate to the consequent phenotype within selected embryos. Previous studies estimated that a threshold concentration of about 45 nM for the second Cdc25 in Drosophila, String, during the entry into mitosis in gastrulation stage [40]. Our FFA measurements revealed a Twine nuclear concentration of 41±9 nM at 20 min into interphase 14, when the decision for an extra mitosis is made (S1 Data).
We have previously shown that the Drosophila homologue of PP6, PpV, acts in parallel with trbl in remodeling of the nuclear cycle [28]. Here, we reveal a mechanism that PpV controls the protein levels of Twine through modulating its phosphosites, thus controlling the timing of cell cycle remodeling. We propose that PpV controls Twine during nuclear cycles resulting in appropriately and uniformly low protein levels prior to interphase 14. In contrast, trbl and other unknown factors are involved in the swift destabilization of Twine in interphase 14. Importantly, we show that PpV keeps a low embryo-to-embryo variation of Twine protein. It is a remarkable property of Drosophila embryos that no variation is observed for the number of nuclear cycles and thus the timing of cell cycle remodeling in wild type. Safeguarding mechanisms for phenotypic uniformity are crucial, especially when thresholds and gradients (temporal decay of Twine) are centrally involved in timing.
Notably, albeit clearly correlating, Twine protein levels may not be the exclusive parameter of cell cycle remodeling, since not all embryos with high Twine concentration underwent an extra mitosis. Likewise, a tripling of twine gene dose to 6-fold only rarely leads to an additional nuclear cycle [18]. In a simple model based on Twine protein destabilization in interphase 14, a dose-dependent phenotype would be expected for the cell cycle remodeling. Other factors may also contribute to this process, such as Wee1. Embryos lacking maternal Wee1 show a cell cycle arrest prior to the remodeling. Wee1/Myt1 and Cdc25 control Cdk1 in pair through T14Y15 phosphosites, and both are regulated by checkpoint kinase Chk1 [41, 42].
Biochemical analysis clearly revealed that the phosphorylation status of Twine in PpV embryos is different than in wild type. It is clear that such an analysis does not reveal whether PpV acts directly or indirectly on the identified phosphosites of Twine. A comprehensive biochemical and enzymatic analysis with purified components would be required to define the molecular relationship. In our study, we focus on the functional relationships. We measured Twine stability by FFA in transgenic embryos, in which all of the eight PpV dependent serine/threonine residues were substituted with either alanine or aspartic acid. The mutations did not affect the general structure and the function of Twine, since both forms can substitute for wild type Twine, i.e., complemented the twine mutation. Despite this, the non-phosphorylatable mutant showed strongly increased protein levels already in nuclear cycle 11, whereas the levels of the phosphomimetic form were low but remained very stable during syncytial cycles. This and the fact that the phosphomimetic form shows a dose-dependent neomorphic activity indicate that the Twine phosphosite mutants are different than the Twine in PpV mutants. This difference may be due to contributions of other protein kinases and phosphatases in regulation of Twine at these sites. The difference may also be due to the degree of phosphorylation. In the phosphosite mutants, the amino acid residues in every Twine molecule were changed, whereas only a fraction of them may be phosphorylated in PpV mutants. Other studies about the phosphorylation status of Twine showed that replacing eight phosphosites to alanine within the Destruction Boxes of Twine led to low Twine levels in nuclear cycle 12, and replacing the three Cdk1-mediated phosphosites to alanine resulted prolonged nuclear cycles 10–13 [21, 43]. We do not know how Twine activity is altered in the phosphosite mutants. The mutated residues may affect kinase activity, substrate specificity, or interactions with other proteins. It is also conceivable that Twine undergoes a reaction cycle of successive and transient phosphorylation and dephosphorylation.
Taken together, we reveal a novel mechanism for Cdc25/Twine function in Drosophila embryonic cell cycle remodeling. We propose that the mitotic decision is determined by two parameters: (1) PpV controlled Twine levels at the onset of interphase 14, and (2) the speed of induced Twine degradation during interphase 14, which involves trbl and other factors. Future experiments will define the mechanisms how PpV controls Twine protein levels and how multiple redundant pathways contribute to the robustness of cell cycle remodeling.
Materials and methods
Genetics
Fly stocks were obtained from the Bloomington Drosophila Stock Center [44], if not otherwise noted. Genetic markers and annotations are described in Flybase [45]. Following fly strains and mutations were used: trbl[EP1119], twine[HB5], and PpV[X9] [28]. Following transgenes were used: Twine-GFP (genomic transgene integrated at the landing site attP2/68A4; S. Blythe, S. Di Talia, and E. Wieschaus), Twine-GFP-8×Ala, Twine-GFP-8×Asp, and nlsGFP Frt[18E]. For PpV mutants, virgin females PpV[X9] Frt[18E] hs-Flp[122] / FM7 were crossed with ovo[D] Frt[18E] / Y males. Germline clones of PpV were induced with the Flippase/Frt system by heat-shock (2× 1 h in the first and second instar larvae).
Molecular genetics, cloning, constructs
The Twine-EGFP transgene was synthesized as a 3.6 kb complementing genomic fragment [16] with an in-frame insertion of a Drosophila codon optimized EGFP at the C-terminus including a linker sequence (S. Blythe, S. Di Talia, and E. Wieschaus). The constructs of mutated Twine phosphosites were synthesized by Eurofins Genomics and cloned into the KpnI/BamHI fragment of Twine-EGFP-pBABR plasmid.
RNA isolation, quantitative RT-PCR
Quantitative PCR and data analysis were carried out according to the protocols of SYBR Green Real-Time PCR Master Mixes and qPCR system software (Thermo Fisher Scientific). cDNA template was synthesized by reverse transcription of Drosophila total RNA, which was isolated by using TRIzol total RNA isolation protocol (Invitrogen). The following primer pairs were used: twine qPCR primers BL16 (GAGTTCCTTGGCGGACACAT) and BL17 (CAGGATAGTCCAGTGCCGGAT); GAPDH qPCR primers MP37F (CACCAGTTCATTCCCAACTT) and MP37R (CTTGCCTTCAGGTGACGC) [46].
Antibodies
Following antibodies were used: Dia (rabbit, guinea pig) [47], Slam (rabbit, guinea pig) [48], Twine (rat) [21], and GFP (mouse; Chemicon, CA, USA).
Embryo microinjection
Embryos were dechorionated with 2.5% sodium hypochlorite bleached for 90 s, dried in a desiccation chamber for 10 to 12 min, then covered by halocarbon oil. Glass capillaries with internal filament were pulled as needles. For focal volume detection, 100 nm FluoSpheres Fluorescent Microspheres (Molecular Probes, OR, USA) were diluted to 1 : 10,000 and injected posteriorly to the embryos. For transgenesis, DNA was injected at 0.1 μg/μl prior to the pole cell formation [49].
Fluorescence fluctuation analysis
Following female genotypes were utilized: Wild type: Twine-GFP/+. PpV: PpV[X9] /ovoD; Twine-GFP/+. Trbl: trbl, Twine-GFP/trbl. Phosphosite mutants: Twine-GFP-8×Ala/TM3, Twine-GFP-8×Asp/TM3. Fluctuation traces were recorded with a 63× oil immersion objective (Planapochromat, NA1.4/oil) and a GaAsP detector on a confocal microscope (Zeiss LSM780) in fluorescence correlation spectrometry (FCS) mode. The data were analyzed as previously reported [33, 34]. Briefly, the intensity traces were analyzed using the number and brightness analysis. Usually 5 traces of each 10 s length were used for calculation of one data point. Time average <i> and variance σ2 were computed for each trace. From these values, we obtained the average brightness per molecule as <e> = (σ2 / <i>) − 1, the average number of molecules within the focal volume as <n> = <i> / <e>, and the absolute concentration as <c> = <n> / (focal volume × Avogadro constant). Determination of the focal volume was conducted using an approach previously described [35]. Images of the spatial concentration map were processed with ImageJ/FIJI. For the measurements of Twine-GFP during nuclear cycles 11–14 (15), we started the recording in early interphases of each cycle when a stable nuclear Twine-GFP signal appeared and a stable nuclear position was observed. For the time dependent decay of Twine-GFP during interphase 14, at least five data points were used for fitting in an exponential curve by linear regression analysis. Fitting curve of exponential trend line was represented by formula c(t) = c0 · e−kt, and coefficient of determination by value R2, which were in the range of R2 > 0.97. The initial concentration (co) was defined as the Twine-GFP levels at the onset of interphase 14 (t = 0) when a complete loss of nuclear Twine-GFP signal in mitosis 13 was observed and the signal started to appear again in the following interphase 14. The decay time was calculated from the exponential constant (k) by formula–(ln 0.5) / k. The statistical significance (p value) of differences between the measured distributions was calculated by Student’s t-test. Details of the analysis and the MATLAB code are available upon request.
Identification of phosphosites in Twine by mass spectrometry
Dechorionated syncytial (0–1.5 h) Twine-GFP/Twine-GFP embryos and embryos from PpV germline clones with Twine-GFP were collected in large batches and snap frozen in liquid nitrogen. Each 10,000 embryos were lysed with a Dounce homogenizer in 1 ml lysis and washing buffer (50 mM Tris/HCl [pH 7.4], 500 mM NaCl, 1 mM DTT, 0.5 mM EDTA, 0.5% Tween 20, 1% Phosphatase Inhibitor Cocktail 3 (Sigma-Aldrich), 1 Tablet/50 ml Protease Inhibitor Cocktail (Roche)). The preparatory experiment was in the scale of about 50,000 embryos. The embryonic lysate was centrifuged twice at 14,000 rpm at 4°C for 15 min, and the supernatant was transferred into a new Eppendorf tube. GFP-TrapA agarose beads (20 μl; Chromotek) were washed thrice with lysis and washing buffer and added to 1 ml of cleared embryonic lysate. After rotating on a wheel for 1 hour at 4°C, spinning at 800 rpm for 2 min, and washing Twine-GFP thrice with lysis and washing buffer, protein was eluted from the beads in Laemmli buffer. Samples were run on SDS-PAGE gradient 4–12% MOPS buffered system and bands were excised and processed. Band slices were digested with trypsin overnight at 30°C and the peptide extracted the next day. Samples were resuspended in 1% formic acid and a 15 μl aliquots of each sample were run either before or after phosphopeptide enrichment. Phosphopeptides were enriched using Ti 4+ IMAC (ReSyn Biosciences) on an UltiMate 3000 RSLC nano system (Thermo Scientific) coupled to an LTQ OrbiTrap Velos Pro (Thermo Scientific). Peptides were initially trapped on an Acclaim PepMap 100 (C18, 100 μm × 2 cm) and then separated on an EasySpray PepMap RSLC C18 column (75 μm × 50 cm) (Thermo Scientific) over a 120 min linear gradient. The data was analyzed by Proteome Discoverer 1.4 (Thermo Scientific) using Mascot 2.4 (Matrix Science) as the search engine. The detailed data sets are available upon request.
Supporting information
S1 Fig [a]
Fluorescence fluctuation analysis for absolute protein concentration profile.S2 Fig [t]
Source data of .S1 Table [wt]
Comparison of non-phosphopeptides in MS analysis of wild type and embryos.S2 Table [mr]
Analysis of phosphorylation sites by mass spectrometry.S1 Data [xlsx]
Source data in Excel sheets with the data as shown in the Figs , and .
Zdroje
1. Krek W, Nigg EA. Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites. EMBO J. 1991;10(2):305–16. 1846803
2. Parker LL, Piwnica-Worms H. Inactivation of the p34cdc2-cyclin B complex by the human WEE1 tyrosine kinase. Science. 1992;257(5078):1955–7. doi: 10.1126/science.1384126 1384126
3. Lucena R, Alcaide-Gavilan M, Anastasia SD, Kellogg DR. Wee1 and Cdc25 are controlled by conserved PP2A-dependent mechanisms in fission yeast. Cell Cycle. 2017;16(5):428–35. doi: 10.1080/15384101.2017.1281476 28103117
4. Perry JA, Kornbluth S. Cdc25 and Wee1: analogous opposites? Cell Div. 2007;2 : 12. doi: 10.1186/1747-1028-2-12 17480229
5. Farrell JA, O'Farrell PH. From egg to gastrula: how the cell cycle is remodeled during the Drosophila mid-blastula transition. Annu Rev Genet. 2014;48 : 269–94. doi: 10.1146/annurev-genet-111212-133531 25195504
6. Liu B, Grosshans J. Link of Zygotic Genome Activation and Cell Cycle Control. Methods Mol Biol. 2017;1605 : 11–30. doi: 10.1007/978-1-4939-6988-3_2 28456955
7. Liu B, Winkler F, Herde M, Witte CP, Grosshans J. A Link between Deoxyribonucleotide Metabolites and Embryonic Cell-Cycle Control. Curr Biol. 2019;29(7):1187–92 e3. doi: 10.1016/j.cub.2019.02.021 30880011
8. Blythe SA, Wieschaus EF. Zygotic genome activation triggers the DNA replication checkpoint at the midblastula transition. Cell. 2015;160(6):1169–81. doi: 10.1016/j.cell.2015.01.050 25748651
9. Djabrayan NJ, Smits CM, Krajnc M, Stern T, Yamada S, Lemon WC, et al. Metabolic Regulation of Developmental Cell Cycles and Zygotic Transcription. Curr Biol. 2019;29(7):1193–8 e5. doi: 10.1016/j.cub.2019.02.028 30880009
10. Vastenhouw NL, Cao WX, Lipshitz HD. The maternal-to-zygotic transition revisited. Development. 2019;146(11).
11. Liu B, Grosshans J. The role of dNTP metabolites in control of the embryonic cell cycle. Cell Cycle. 2019;18(21):2817–27. doi: 10.1080/15384101.2019.1665948 31544596
12. Sung HW, Spangenberg S, Vogt N, Grosshans J. Number of nuclear divisions in the Drosophila blastoderm controlled by onset of zygotic transcription. Curr Biol. 2013;23(2):133–8. doi: 10.1016/j.cub.2012.12.013 23290555
13. Grosshans J, Muller HA, Wieschaus E. Control of cleavage cycles in Drosophila embryos by fruhstart. Dev Cell. 2003;5(2):285–94. doi: 10.1016/s1534-5807(03)00208-9 12919679
14. Grosshans J, Wieschaus E. A genetic link between morphogenesis and cell division during formation of the ventral furrow in Drosophila. Cell. 2000;101(5):523–31. doi: 10.1016/s0092-8674(00)80862-4 10850494
15. Gawlinski P, Nikolay R, Goursot C, Lawo S, Chaurasia B, Herz HM, et al. The Drosophila mitotic inhibitor Fruhstart specifically binds to the hydrophobic patch of cyclins. EMBO Rep. 2007;8(5):490–6. doi: 10.1038/sj.embor.7400948 17431409
16. Alphey L, Jimenez J, White-Cooper H, Dawson I, Nurse P, Glover DM. twine, a cdc25 homolog that functions in the male and female germline of Drosophila. Cell. 1992;69(6):977–88. doi: 10.1016/0092-8674(92)90616-k 1606618
17. Courtot C, Fankhauser C, Simanis V, Lehner CF. The Drosophila cdc25 homolog twine is required for meiosis. Development. 1992;116(2):405–16. 1286615
18. Edgar BA, Datar SA. Zygotic degradation of two maternal Cdc25 mRNAs terminates Drosophila's early cell cycle program. Genes Dev. 1996;10(15):1966–77. doi: 10.1101/gad.10.15.1966 8756353
19. Farrell JA, O'Farrell PH. Mechanism and regulation of Cdc25/Twine protein destruction in embryonic cell-cycle remodeling. Curr Biol. 2013;23(2):118–26. doi: 10.1016/j.cub.2012.11.036 23290551
20. Farrell JA, Shermoen AW, Yuan K, O'Farrell PH. Embryonic onset of late replication requires Cdc25 down-regulation. Genes Dev. 2012;26(7):714–25. doi: 10.1101/gad.186429.111 22431511
21. Di Talia S, She R, Blythe SA, Lu X, Zhang QF, Wieschaus EF. Posttranslational control of Cdc25 degradation terminates Drosophila's early cell-cycle program. Curr Biol. 2013;23(2):127–32. doi: 10.1016/j.cub.2012.11.029 23290553
22. Mata J, Curado S, Ephrussi A, Rorth P. Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell. 2000;101(5):511–22. doi: 10.1016/s0092-8674(00)80861-2 10850493
23. Seher TC, Leptin M. Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr Biol. 2000;10(11):623–9. doi: 10.1016/s0960-9822(00)00502-9 10837248
24. Frazer C, Young PG. Phosphorylation Mediated Regulation of Cdc25 Activity, Localization and Stability In Protein Phosphorylation in Human Health. In: Huang C, editor. InTech. Rijeka, Croatia: InTech; 2009. p. 395–436.
25. Mann DJ, Dombradi V, Cohen PT. Drosophila protein phosphatase V functionally complements a SIT4 mutant in Saccharomyces cerevisiae and its amino-terminal region can confer this complementation to a heterologous phosphatase catalytic domain. EMBO J. 1993;12(12):4833–42. 8223492
26. Bastians H, Ponstingl H. The novel human protein serine/threonine phosphatase 6 is a functional homologue of budding yeast Sit4p and fission yeast ppe1, which are involved in cell cycle regulation. J Cell Sci. 1996;109 (Pt 12):2865–74.
27. Ohama T. The multiple functions of protein phosphatase 6. Biochim Biophys Acta Mol Cell Res. 2019;1866(1):74–82. doi: 10.1016/j.bbamcr.2018.07.015 30036567
28. Liu B, Sung HW, Grosshans J. Multiple Functions of the Essential Gene PpV in Drosophila Early Development. G3 (Bethesda). 2019;9(11):3583–93.
29. Yu SR, Burkhardt M, Nowak M, Ries J, Petrasek Z, Scholpp S, et al. Fgf8 morphogen gradient forms by a source-sink mechanism with freely diffusing molecules. Nature. 2009;461(7263):533–6. doi: 10.1038/nature08391 19741606
30. Ries J, Yu SR, Burkhardt M, Brand M, Schwille P. Modular scanning FCS quantifies receptor-ligand interactions in living multicellular organisms. Nat Methods. 2009;6(9):643–5. doi: 10.1038/nmeth.1355 19648917
31. Abu-Arish A, Porcher A, Czerwonka A, Dostatni N, Fradin C. High mobility of bicoid captured by fluorescence correlation spectroscopy: implication for the rapid establishment of its gradient. Biophys J. 2010;99(4):L33–5. doi: 10.1016/j.bpj.2010.05.031 20712981
32. Bhattacharya D, Talwar S, Mazumder A, Shivashankar GV. Spatio-temporal plasticity in chromatin organization in mouse cell differentiation and during Drosophila embryogenesis. Biophys J. 2009;96(9):3832–9. doi: 10.1016/j.bpj.2008.11.075 19413989
33. Chen Y, Muller JD, Ruan Q, Gratton E. Molecular brightness characterization of EGFP in vivo by fluorescence fluctuation spectroscopy. Biophys J. 2002;82(1 Pt 1):133–44.
34. Digman MA, Dalal R, Horwitz AF, Gratton E. Mapping the number of molecules and brightness in the laser scanning microscope. Biophys J. 2008;94(6):2320–32. doi: 10.1529/biophysj.107.114645 18096627
35. Buschmann V, Kramer B, Koberlink F. Quantitative FCS: Determination of the Confocal Volume by FCS and Bead Scanning with MicroTime 200. PicoQuant. Berlin: Application Note; 2009. p. 8.
36. Mazzolini L, Broban A, Froment C, Burlet-Schiltz O, Besson A, Manenti S, et al. Phosphorylation of CDC25A on SER283 in late S/G2 by CDK/cyclin complexes accelerates mitotic entry. Cell Cycle. 2016;15(20):2742–52. doi: 10.1080/15384101.2016.1220455 27580187
37. Mailand N, Podtelejnikov AV, Groth A, Mann M, Bartek J, Lukas J. Regulation of G(2)/M events by Cdc25A through phosphorylation-dependent modulation of its stability. EMBO J. 2002;21(21):5911–20. doi: 10.1093/emboj/cdf567 12411508
38. Donzelli M, Squatrito M, Ganoth D, Hershko A, Pagano M, Draetta GF. Dual mode of degradation of Cdc25 A phosphatase. EMBO J. 2002;21(18):4875–84. doi: 10.1093/emboj/cdf491 12234927
39. Shimuta K, Nakajo N, Uto K, Hayano Y, Okazaki K, Sagata N. Chk1 is activated transiently and targets Cdc25A for degradation at the Xenopus midblastula transition. EMBO J. 2002;21(14):3694–703. doi: 10.1093/emboj/cdf357 12110582
40. Di Talia S, Wieschaus EF. Short-term integration of Cdc25 dynamics controls mitotic entry during Drosophila gastrulation. Dev Cell. 2012;22(4):763–74. doi: 10.1016/j.devcel.2012.01.019 22483720
41. Stumpff J, Duncan T, Homola E, Campbell SD, Su TT. Drosophila Wee1 kinase regulates Cdk1 and mitotic entry during embryogenesis. Curr Biol. 2004;14(23):2143–8. doi: 10.1016/j.cub.2004.11.050 15589158
42. Price D, Rabinovitch S, O'Farrell PH, Campbell SD. Drosophila wee1 has an essential role in the nuclear divisions of early embryogenesis. Genetics. 2000;155(1):159–66. 10790391
43. Deneke VE, Melbinger A, Vergassola M, Di Talia S. Waves of Cdk1 Activity in S Phase Synchronize the Cell Cycle in Drosophila Embryos. Dev Cell. 2016;38(4):399–412. doi: 10.1016/j.devcel.2016.07.023 27554859
44. Whitworth C. The Bloomington Drosophila Stock Center: Management, Maintenance, Distribution, and Research. In: Jarret RL, McCluskey K, editors. The Biological Resources of Model Organisms. London: Taylor & Francis Group; 2019. p. 145–62.
45. Gramates LS, Marygold SJ, Santos GD, Urbano JM, Antonazzo G, Matthews BB, et al. FlyBase at 25: looking to the future. Nucleic Acids Res. 2017;45(D1):D663–D71. doi: 10.1093/nar/gkw1016 27799470
46. Yan S, Acharya S, Groning S, Grosshans J. Slam protein dictates subcellular localization and translation of its own mRNA. PLoS Biol. 2017;15(12):e2003315. doi: 10.1371/journal.pbio.2003315 29206227
47. Wenzl C, Yan S, Laupsien P, Grosshans J. Localization of RhoGEF2 during Drosophila cellularization is developmentally controlled by Slam. Mech Dev. 2010;127(7–8):371–84. doi: 10.1016/j.mod.2010.01.001 20060902
48. Acharya S, Laupsien P, Wenzl C, Yan S, Grosshans J. Function and dynamics of slam in furrow formation in early Drosophila embryo. Dev Biol. 2014;386(2):371–84. doi: 10.1016/j.ydbio.2013.12.022 24368071
49. Winkler F, Kriebel M, Clever M, Groning S, Grosshans J. Essential Function of the Serine Hydroxymethyl Transferase (SHMT) Gene During Rapid Syncytial Cell Cycles in Drosophila. G3 (Bethesda). 2017;7(7):2305–14.
Článek Loss of FOXM1 in macrophages promotes pulmonary fibrosis by activating p38 MAPK signaling pathwayČlánek Inference of past demography, dormancy and self-fertilization rates from whole genome sequence dataČlánek Eliciting priors and relaxing the single causal variant assumption in colocalisation analysesČlánek Integrative and quantitative view of the CtrA regulatory network in a stalked budding bacteriumČlánek The transcription and export complex THO/TREX contributes to transcription termination in plantsČlánek Loss of Cdc13 causes genome instability by a deficiency in replication-dependent telomere capping
Článek vyšel v časopisePLOS Genetics
Nejčtenější tento týden
2020 Číslo 4- Perorální semaglutid ve formě tablet k léčbě DM 2. typu nyní dostupný i v Česku
- Dlouhodobá recidiva a komplikace spojené s elektivní operací břišní kýly
- Využití diklofenaku ve formě gelu v terapii seboroické keratózy
- Co se skrývá za ChatGPT? Umělá inteligence s potenciálním využitím i v klinické medicíně
- Jak a kdy u celiakie začíná reakce na lepek? Možnou odpověď poodkryla čerstvá kanadská studie
-
Všechny články tohoto čísla
- Dynamic localization of SPO11-1 and conformational changes of meiotic axial elements during recombination initiation of maize meiosis
- The plant mobile domain proteins MAIN and MAIL1 interact with the phosphatase PP7L to regulate gene expression and silence transposable elements in Arabidopsis thaliana
- Targeting mitochondrial and cytosolic substrates of TRIT1 isopentenyltransferase: Specificity determinants and tRNA-i6A37 profiles
- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- XPF-ERCC1 protects liver, kidney and blood homeostasis outside the canonical excision repair pathways
- Technical and social issues influencing the adoption of preprints in the life sciences
- The nanophthalmos protein TMEM98 inhibits MYRF self-cleavage and is required for eye size specification
- DNA methylation-mediated repression of exosomal miR-652-5p expression promotes oesophageal squamous cell carcinoma aggressiveness by targeting PARG and VEGF pathways
- Is imprinting the result of “friendly fire” by the host defense system?
- The coordinate actions of calcineurin and Hog1 mediate the stress response through multiple nodes of the cell cycle network
- XPF–ERCC1: Linchpin of DNA crosslink repair
- A missense variant in Mitochondrial Amidoxime Reducing Component 1 gene and protection against liver disease
- Deconstructing cerebellar development cell by cell
- The genomic landscape of undifferentiated embryonal sarcoma of the liver is typified by C19MC structural rearrangement and overexpression combined with TP53 mutation or loss
- Variants encoding a restricted carboxy-terminal domain of SLC12A2 cause hereditary hearing loss in humans
- Molecular genetics of maternally-controlled cell divisions
- Waking up quiescent neural stem cells: Molecular mechanisms and implications in neurodevelopmental disorders
- Parallelism in eco-morphology and gene expression despite variable evolutionary and genomic backgrounds in a Holarctic fish
- An integrated analysis of cell-type specific gene expression reveals genes regulated by REVOLUTA and KANADI1 in the Arabidopsis shoot apical meristem
- Discovery of novel hepatocyte eQTLs in African Americans
- Loss-of-function tolerance of enhancers in the human genome
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum
- Relaxed constraint and functional divergence of the progesterone receptor (PGR) in the human stem-lineage
- Is adaptation limited by mutation? A timescale-dependent effect of genetic diversity on the adaptive substitution rate in animals
- Tryptamine accumulation caused by deletion of MrMao-1 in Metarhizium genome significantly enhances insecticidal virulence
- Postglacial migration shaped the genomic diversity and global distribution of the wild ancestor of lager-brewing hybrids
- Conserved nuclear hormone receptors controlling a novel plastic trait target fast-evolving genes expressed in a single cell
- Pathological mechanism and antisense oligonucleotide-mediated rescue of a non-coding variant suppressing factor 9 RNA biogenesis leading to hemophilia B
- Loss of FOXM1 in macrophages promotes pulmonary fibrosis by activating p38 MAPK signaling pathway
- Ribosome binding protein GCN1 regulates the cell cycle and cell proliferation and is essential for the embryonic development of mice
- Inference of past demography, dormancy and self-fertilization rates from whole genome sequence data
- Drosophila NUAK functions with Starvin/BAG3 in autophagic protein turnover
- FANCJ helicase promotes DNA end resection by facilitating CtIP recruitment to DNA double-strand breaks
- Getting clear about the F-word in genomics
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Placental imprinting: Emerging mechanisms and functions
- Eliciting priors and relaxing the single causal variant assumption in colocalisation analyses
- Mutations in SPATA13/ASEF2 cause primary angle closure glaucoma
- Functional diversification of Paramecium Ku80 paralogs safeguards genome integrity during precise programmed DNA elimination
- Integrative and quantitative view of the CtrA regulatory network in a stalked budding bacterium
- Analysis of genes within the schizophrenia-linked 22q11.2 deletion identifies interaction of night owl/LZTR1 and NF1 in GABAergic sleep control
- Interaction between host genes and Mycobacterium tuberculosis lineage can affect tuberculosis severity: Evidence for coevolution?
- Quantitative live imaging of Venus::BMAL1 in a mouse model reveals complex dynamics of the master circadian clock regulator
- O-linked β-N-acetylglucosamine transferase plays an essential role in heart development through regulating angiopoietin-1
- The Drosophila FUS ortholog cabeza promotes adult founder myoblast selection by Xrp1-dependent regulation of FGF signaling
- The transcription and export complex THO/TREX contributes to transcription termination in plants
- Loss of Cdc13 causes genome instability by a deficiency in replication-dependent telomere capping
- Leveraging gene co-expression patterns to infer trait-relevant tissues in genome-wide association studies
- Fluorescence fluctuation analysis reveals PpV dependent Cdc25 protein dynamics in living embryos
- Correction: Exome sequencing in multiple sclerosis families identifies 12 candidate genes and nominates biological pathways for the genesis of disease
- C9orf72/ALFA-1 controls TFEB/HLH-30-dependent metabolism through dynamic regulation of Rag GTPases
- Inositol 1,4,5-trisphosphate receptors are essential for fetal-maternal connection and embryo viability
- ArdC, a ssDNA-binding protein with a metalloprotease domain, overpasses the recipient hsdRMS restriction system broadening conjugation host range
- The Drosophila actin nucleator DAAM is essential for left-right asymmetry
- Translesion synthesis polymerases are dispensable for C. elegans reproduction but suppress genome scarring by polymerase theta-mediated end joining
- Juvenile hormone suppresses aggregation behavior through influencing antennal gene expression in locusts
- UNBRANCHED3 Expression and Inflorescence Development is Mediated by UNBRANCHED2 and the Distal Enhancer, KRN4, in Maize
- Dynamic miRNA-mRNA interactions coordinate gene expression in adult Anopheles gambiae
- Long noncoding RNA PAHAL modulates locust behavioural plasticity through the feedback regulation of dopamine biosynthesis
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Molecular genetics of maternally-controlled cell divisions
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum
Přihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání